Overview

Distribution

National Distribution

Canada

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia assimilata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATCGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAGATTTATAATACTATTGTCACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATGATTGGAGGATTTGGTAATTGATTAGTACCTCTTATACTAGGTGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTATTACATTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCTGGGACTGGATGAACAGTTTATCCTCCTTTATCATCAAATATTGCCCATGGTGGAAGTTCAGTAGATTTAGCCATTTTTTCACTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACAACCATTATTAATATACGTTTAAATAATATATTTTTTGATCAATTACCTTTATTCGTTTGAGCAGTAGGGATTACAGCTTTTTTACTTCTTTTATCTTTACCAGTTTTAGCTGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia assimilata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Currant Pug

The Currant Pug (Eupithecia assimilata) is a moth of the family Geometridae. It is found across the Nearctic and Palearctic regions and the Near East.

This species is rather similar to the Wormwood Pug, with warm brown forewings and a triangle of black spots close to the costa, but can be recognized by its broader wings and a more prominent white spot close to the tornus. The wingspan is 17–22 mm. Two broods are produced each year with adults on the wing in May and June and again in August.

The larva, as the name suggests, feeds on currant, but will also feed on hop. The species overwinters as a pupa.

References[edit]

  • Chinery, Michael. Collins Guide to the Insects of Britain and Western Europe (1986, reprinted 1991)
  • Skinner, Bernard. Colour Identification Guide to Moths of the British Isles (1984)


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Bolte (1990) determined that the North American Eupithecia fumosa and European E. assimilata are conspecific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!