Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Horisme vitalbata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Horisme vitalbata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCATTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGGTTTGGAAATTGATTAATTCCATTAATATTGGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCTATTACACTTTTAATCTCTAGAAGAATCGTAGAAAATGGAGCTGGCACTGGATGAACGGTATACCCCCCCCTATCATCCAATATTGCCCACGCAGGAAGATCTGTTGACTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCTTCTATTTTAGGGGCAATTAATTTTATTACCACAATTATTAATATACGATTAAATAATATATTCTTTGATCAATTACCTTTATTTGTATGAGCAGTAGGTATTACAGCTTTTTTACTTCTTCTTTCTTTACCTGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCCTTTTTTGATCCTGCTGGGGGAGGAGACCCCATCCTCTACCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horisme vitalbata

The Small Waved Umber (Horisme vitalbata) is a moth of the family Geometridae. The species occurs in Europe.

The wingspan is 30–35 mm. The length of the forewings is 15–17 mm. The moths fly in two generations from May to June and again in August.[1]

The larva feed on Clematis vitalba.

Notes[edit]

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!