Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Poecile montana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Poecile montana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAGACATTGGCACTCTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATCCGTGCAGAACTGGGTCAACCAGGAGCCCTTCTGGGAGATGACCAGATCTACAACGTAGTCGTTACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATACCAATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTCCTACCCCCTTCCTTCCTACTCCTATTAGCCTCCTCCACAGTCGAAGCAGGTGCAGGAACAGGATGAACAGTCTACCCACCCCTAGCCGGCAACCTCGCCCACGCCGGAGCATCAGTAGACCTGGCCATCTTCTCCCTACACCTAGCAGGTATCTCATCAATCCTAGGAGCAATCAACTTCATCACAACTGCAATCAACATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTACTAATCACCGCAGTTCTCCTCCTACTCTCACTTCCAGTTCTCGCCGCCGGCATCACCATGCTCCTCACCGATCGCAATCTTAACACCACTTTCTTCGACCCGGCAGGAGGAGGAGACCCAGTGCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTACCAGGATTTGGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 24,000,000-42,000,000 breeding pairs, equating to 72,000,000-126,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 147,000,000-504,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs in China; c.100-100,000 breeding pairs in Japan and c.10,000-100,000 breeding pairs in Russia and (for the subspecies songara) c.100-10,000 breeding pairs in China (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Willow tit

In the UK

The willow tit (Poecile montanus) is a passerine bird in the tit family Paridae. It is a widespread and common resident breeder throughout temperate and subarctic Europe and northern Asia. It is more of a conifer specialist than the closely related marsh tit, which explains it breeding much further north. It is resident, and most birds do not migrate.

In the east of its range it is much paler than marsh tit, but as one goes west the various races become increasingly similar, so much so that it was not recognised as a breeding bird in Great Britain until the end of the 19th century, despite being widespread.

The willow tit is distinguished from the marsh tit by a sooty brown instead of a glossy blue black cap; the general colour is otherwise similar, though the under parts are more buff and the flanks distinctly more rufous; the pale buff edgings to the secondaries form a light patch on the closed wing. The feathers of the crown and the black bib under the bill are longer, but this is not an easily noticed character. However, the more graduated tail (not square) shows distinctly when spread. Length is 11.5 cm, and wings range from 60–70 mm.

The commonest call is a nasal zee, zee, zee, but the notes of the bird evidently vary considerably. Occasionally a double note, ipsee, ipsee, is repeated four or five times.

The willow tit often excavates its own nesting hole, even piercing hard bark; this is usually in a rotten stump or in a tree, more or less decayed. Most nests examined are cups of felted material, such as fur, hair and wood chips, but feathers are sometimes used. The number of eggs varies from six to nine, with reddish spots or blotches..

Birds feed on insects, caterpillars, and seeds, much like other tits. This species is parasitised by the moorhen flea, Dasypsyllus gallinulae.[2]

Status in UK[edit]

According to the RSPB, the willow tit is in rapid decline and is now considered a 'red status' bird. This status was given for two factors:[3]

  1. BDp¹ - severe, at least 50%, decline in UK breeding population over last 25 years
  2. BDP² - severe, at least 50%, contraction of UK breeding range over the entire period used for assessments since the first BoCC review starting in 1969

Conservation work is continuing to determine the cause of the willow tit's decline in population and to try to identify ways to improve the situation.[4]

Systematics[edit]

Most authorities retain Poecile as a subgenus within the genus Parus, but the American Ornithologists' Union treats it as a distinct genus. This is supported by mtDNA cytochrome b sequence analysis; within Poecile, the willow tit is part of a group of Eurasian "typical chickadees" that includes also the marsh tit, Père David's tit, and the Songar tit (Gill et al. 2005, del Hoyo et al. 2007).

The genus name has often been treated as feminine (giving the species name ending montana); however, this was not specified by the original genus author Johann Jakob Kaup, and under the International Code of Zoological Nomenclature the genus name must therefore be treated by default as masculine, giving the name ending montanus (del Hoyo et al. 2007).

At one time the willow tit was considered conspecific with the black-capped chickadee of North America due to their very similar appearance. This is seen in an older version of the Peterson Field Guide, Birds of Britain and Europe. Underneath the name it states; "N Am. Black-Capped Chickadee" as an alternate name. In fact the willow tit, black-capped chickadee, marsh tit and Carolina chickadee are all very similar to one another in appearance.

Appearances[edit]

- The willow tit is referenced in one of the musical numbers in the comedic opera "The Mikado" written by Gilbert and Sullivan, (On a Tree By a River).

References[edit]

  1. ^ BirdLife International (2012). "Parus montanus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Rothschild, Miriam; Clay, Theresa (1953). Fleas, Flukes and Cuckoos. A study of bird parasites. London: Collins. p. 113. 
  3. ^ Birds of Conservation Concern 3 - 2009, accessed 2012-11-19
  4. ^ "Willow Tit". RSPB. Retrieved 2012-05-18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!