Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia exiguata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGGACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCTTAATATTAGGAGCTCCAGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGATTATTACCTCCCTCTATTACACTTTTAATTTCAAGAAGAATTGTGGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCCCTATCATCTAACATTGCTCATGGAGGAAGTTCTGTAGATTTAGCTATTTTTTCCTTACACTTAGCTGGAATCTCATCTATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGTTTAAATAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCAGTAGGAATTACAGCCTTTTTACTTTTATTATCTTTGCCTGTTTTAGCTGGTGCTATTACGATACTTTTAACTGACCGAAATTTAAACACATCATTTTTTGACCCCGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia exiguata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mottled Pug

The Mottled Pug (Eupithecia exiguata) is a moth of the family Geometridae. It is found across the Palearctic region apart from around the Mediterranean Sea. It is common in the British Isles apart from Scotland where it is rather local.

The wingspan is 20–22 mm and the forewings are brown marked with pale radial lines and a black discal spot. The hindwings are cream or grey also with a discal spot. The species flies at night in May and June and is attracted to light, sometimes in large numbers.

The larva feeds on the foliage of various trees and shrubs (see list below). The species overwinters as a pupa.

Subspecies[edit]

Recorded food plants[edit]

References[edit]

  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!