Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Bay-winged cowbirds are native to central and southern South America, making their homes primarily in the Andean highlands. This species generally is found throughout Argentina, with the westernmost portions of its range abutting the eastern slopes of the Andes. Bay-winged cowbirds may be found in Uruguay, Paraguay, Bolivia, and in the southwestern corner of Brazil. An isolated population of bay-winged cowbirds is found at the mouth of the Amazon River (Jaramillo and Burke 1999).

Biogeographic Regions: neotropical (Native )

  • Jaramillo, A., P. Burke. 1999. New World Blackbirds: The Icterids. Princeton, NJ: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bay-winged cowbirds are a medium-sized species of New World blackbird. They are largely sexually monomorphic, to the point of being indistinguishable in the field, though males tend to be slightly heavier (Fraga 1992; Jaramillo and Burke 1999). However, an old source (Hamilton and Orians 1965) seems to indicate a small but statistically significant difference in body mass between the sexes. This species is characterized by a light gray body and a charcoal gray tail. The wings are mostly rust-colored, though the retrices (flight feathers) are tipped brown. The legs and claws are black, as are the lores. The black lores and face combine to create what has been aptly described as a “mask”. The bill is short, conical, and black; Jaramillo and Burke (1999) note that the bill is “finch-like” in size and shape.

Juveniles are nearly identical to adults and are probably indistinguishable from adults to an observer in the field; however, they are usually slightly darker, with dark streaks on the body. The tail feathers in juveniles and in freshly molted adults may have reddish markings. In addition, the corner of the mouth in juveniles is whitish; this along with the juvenile’s pink mouth lining changes to black in adulthood. Finally, the bill tends to be slightly lighter in coloration in juvenile specimens (Jaramillo and Burke 1999).

Pale bay-winged cowbirds, Agelaioides badius fringillarius, have plumage that is substantially different from the nominate subspecies. Although patterns are largely conserved, the body is brownish-gray, with a blackish-brown mask and brown remiges (long tail feathers). It is currently debated whether the pale subspecies of bay-winged cowbird should actually be considered its own species (Jaramillo and Burke 1999).

Juvenile screaming cowbirds (Molothrus rufoaxillaris) are nest parasites of bay-winged cowbirds, which are used as their primary host. Although the two species are nearly impossible to tell apart more than a few days after hatching, Fraga (1979) states that there are four general differences between the young of screaming cowbirds and the young of bay-winged cowbirds. Fraga (1979) notes that in the first few days after hatching bay-winged cowbirds have orange skin, while the parasitic screaming cowbirds are pink. Second, while bay-winged cowbird hatchlings have a dark patch surrounding the egg tooth, screaming cowbird hatchlings have uniformly pink bills. Third, screaming cowbirds sometimes outgrow their bay-winged cowbird hosts; noting sexual dimorphism in screaming cowbirds, Fraga (1979) suggests that unusually large screaming cowbird juveniles are likely to be males. Finally, unlike bay-winged cowbird juveniles, screaming cowbirds do not solicit allopreening (interspecies preening) behavior (Fraga 1979).

Average mass: 45 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Fraga, R. 1992. Biparental care in bay-winged cowbirds (Molothrus badius). Ardea, 80: 389-393.
  • Fraga, R. 1979. Differences between nestlings and fledglings of Screaming and Bay-winged cowbirds. The Wilson Bulletin, 91(1): 151-154.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Like other members of the American blackbird family, Agelaioides badius is an edge species. They prefer to nest in open woodland, in scrub, and in grasslands with scattered trees. In particular, bay-winged cowbirds are readily seen in chaco, a type of scrub forest, and in Patagonia. Jaramillo and Burke (1999) note that bay-winged cowbirds use hackberry bushes as preferred nesting habitat. Individuals belonging to this species also frequent disturbed urban and agricultural areas, and have been spotted in urban parks in Buenos Aires (Jaramillo and Burke 1999).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults are primarily granivores, feeding on the seeds of cultivated crops and wild plants; corn (Zea mays) and rice (Oryza sativa) are favored species. Both adults and nestlings will consume insects, especially grasshoppers and locusts (Orthoptera); butterflies, moths, and their larvae (Lepidoptera); and beetles (Coleoptera). Nestlings are fed primarily insects (Lowther 2010).

Animal Foods: insects

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore ); herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Bay-winged cowbirds fall prey to a number of species, especially raptors and opossums. Bay-winged cowbirds may play a minor role in regulating the populations of prey insects.

Nearly all bay-winged cowbird nests are affected by brood parasites. In particular, bay-winged cowbirds are preferred hosts for screaming cowbird (Molothrus rufoaxillaris) eggs and young. Shiny cowbirds (Molothrus bonariensis), another species of brood parasite, affect about one fifth of bay-winged cowbird broods; parasitism by this species is often concurrent with screaming cowbird parasitism. Parasitized broods are often abandoned: the breeding pair will often either construct or co-opt a second or third nest. Likewise, brood parasites often affect secondary or tertiary nests (De Marisco and Reboreda 2010).

Brood parasitism is a significant factor contributing to a nest’s failure. The ancillary effects of nest parasitism—hatchling malnutrition due to increased competition for food, parental desertion of parasitized nests, and increased risk of predation—contribute to nest failure, and generally more severe in nests with larger numbers of parasitoids (De Marisco and Reboreda 2010).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Primary avian predators of bay-winged cowbirds are roadside hawks (Buteo magnirostris) and Chimango caracaras (Milvago chimango) (Fraga 1992). Nocturnal predation by the opossum, Didelphis albiventris tends to affect roosting females (Fraga 1992). As noted previously, shiny cowbirds and screaming cowbirds are brood parasites; members of both species occasionally puncture and remove an egg from a host’s nest before laying their own eggs (De Marisco and Reboreda 2010).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The song is a continuous stream of notes, described by Jaramillo and Burke (1999) as dissonant, “hollow”, and with a quality that brings to mind “musicians that never really get in tune”. Groups of bay-winged cowbirds sing at once. Jaramillo and Burke (1999) describe calls as either a low or a high ‘chuck’; the high-pitched version of the call is used as an alarm, while the low-pitched call is used elsewhere. Jaramillo and Burke (1999) note that members of this species will infrequently give a cry described as ‘peeeooh’, though the purpose that this call serves is not explained.

Communication Channels: acoustic

Other Communication Modes: choruses

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Banding studies indicate that this species is capable of living to more than six years of age in the wild. The maximum longevity for members of this species has not been established (Jaramillo and Burke 1999).

Range lifespan

Status: wild:
6 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bay-winged cowbirds were initially thought to always be monogamous (Hamilton 1965), although observations made by Fraga (1972) of banded birds indicate that some females mate with a different male each breeding season, which generally lasts from November through March. In keeping with their semi-colonial nesting habits, mated pairs of bay-winged cowbirds usually receive assistance in provisioning and nest defense from other adults (Fraga 1972; Fraga 1992). These individuals, invariably non-breeding ‘helper’ males, are found assisting virtually all bay-winged cowbird nests (Fraga 1972).

Mating System: monogamous ; polyandrous

As with other New World blackbirds, females of this species typically lay one clutch of between two and five eggs (De Marisco and Reboreda 2010, but see Fraga 1972). Eggs are usually white or light blue with dark scrawling patterns (Jaramillo and Burke 1999); bay-winged cowbird eggs are similar to those of other blackbirds. Occasionally, more than one female will lay eggs in a single nest (De Marisco and Reboreda 2010).

Bay-winged cowbirds usually do not build their own nests. Instead, they lay eggs in a nest built and formerly occupied by another species. Usually, co-opted nests were previously abandoned but, when there is much competition for nests, bay-winged cowbirds have been known to forcibly evict the tenants of occupied nests. Bay-winged cowbirds prefer to occupy covered nests, which afford the eggs and young the greatest protection from predators and parasitic species (Jaramillo and Burke 1999).

Great Kiskadees (Pitangus sulphuratus) are a primary source for abandoned nests; bay-winged cowbirds have also been observed using the nests of ovenbirds (Furnariidae) and firewood gatherers (Anumbius annumbi), as well as woodpecker (Picidae) nest holes and artificial nest boxes (De Marisco and Reboreda 2010; Lowther 2010; Jaramillo and Burke 1999). De Marisco and Reboreda (2010) noted that in an isolated case, a pair of bay-winged cowbirds was observed occupying an abandoned paper wasp (Vespidae) nest.

If no nests are available, bay-winged cowbirds have been known to construct their own nests, made of fine grasses and other plant fiber. These nests are generally placed in the upper branches of trees, between 1.3 m to 10 m (~4 ft to 33 ft) from the ground (De Marisco and Reboreda 2010); populations residing in tropical scrub tend to prefer hackberry bushes (Jaramillo and Burke 1999). Nests are primarily constructed by females, though males do contribute to nest-building activities (Fraga 1972; Fraga 1992).

Breeding interval: Bay-winged cowbirds breed once yearly

Breeding season: The breeding season generally lasts from November to March, but in some areas may begin in September

Range eggs per season: 2 to 5.

Average eggs per season: 4.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Males aggressively defend their nest from predators and parasites through the nesting season (Fraga 1972; Fraga 1992; Hamilton 1965). In many cases, nest defense by both breeding males and non-breeding ‘helper’ males takes the form of ‘mobbing’: an individual will charge its target while calling loudly (Fraga 1972). Both parents care for and protect their young through fledging and some may remain behind as helpers for additional seasons before becoming independent.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Jaramillo, A., P. Burke. 1999. New World Blackbirds: The Icterids. Princeton, NJ: Princeton University Press.
  • De Marisco, M., J. Reboreda. 2010. Brood parasitism increases mortality of bay-winged cowbird nests. The Condor, 112(2): 407-417.
  • Fraga, R. 1992. Biparental care in bay-winged cowbirds (Molothrus badius). Ardea, 80: 389-393.
  • Fraga, R. 1972. Cooperative breeding and a case of successive polyandry in the Bay-winged Cowbird. The Auk, 89(2): 447-449.
  • Hamilton, W., G. Orians. 1965. Evolution of brood parasitism in altricial birds. The Condor, 67(4): 361-382.
  • Lowther, P. 2010. "Bay-Winged Cowbird: Life History" (On-line). Neotropical Birds. Accessed August 11, 2010 at http://neotropical.birds.cornell.edu/portal/species/lifehistory?p_p_spp=34598.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agelaioides badius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTTATCAACCGATGATTATTCTCAACTAACCACAAAGACATTGGAACCCTATACTTAATTTTCGGCGCATGAGCCGGAATGGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTATACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATCGGAGGATTCGGAAACTGACTGGTCCCCCTAATAATTGGCGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCCCCATCTTTCCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGTGTAGGGACAGGCTGAACAGTATACCCCCCACTAGCAGGCAACCTAGCCCACGCTGGAGCTTCAGTCGACCTAGCAATTTTCTCTCTACATCTAGCCGGTATCTCTTCAATTCTAGGGGCAATCAACTTTATTACAACAGCCATCAACATGAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCCGTCCTAATCACCGCAGTGCTATTACTTCTATCTCTCCCAGTTCTAGCCGCAGGGATTACAATGCTTCTCACAGACCGCAACCTTAACACCACATTCTTCGATCCTGCTGGAGGAGGAGACCCTGTACTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCTTAATCCTCCCAGGATTCGGGATCATCTCCCATGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agelaioides badius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The IUCN lists this species as Least Concern (LC) because, although definitive data have not been gathered, it does not appear that this species’ population size and growth projections meet the conditions necessary to label bay-winged cowbirds as threatened or endangered (Butchart et al. 2010).

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This species does not appear to have any negative effects on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In recent decades, this species attracted a great deal of attention in the ornithological community because of its unusual reproductive strategy and its presumed close genetic relation to South American cowbirds. As an unusual member of Icteridae, bay-winged cowbirds are likely to be of interest to visitors that wish to observe Argentine wildlife.

Positive Impacts: ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baywing

The baywing (Agelaioides badius), also known as the bay-winged cowbird, is a species of bird in the Icteridae family. It is currently placed in the genus Agelaioidesmonotypic at present[citation needed] –, but has traditionally been placed in the genus Molothrus. It is found in the northern half of Argentina, Bolivia, Uruguay, Paraguay and southern and central Brazil, with an isolated population in north-eastern Brazil. The latter population is sometimes considered a separate species, the pale cowbird or pale baywing (Agelaioides fringillarius). The baywing has been recorded as a vagrant in Chile.

Description and behavior[edit]

A. b. fringillarius.

It has a total length of approximately 18 cm (7 in). It is overall ashy-brown with contrasting black lores and rufous wings. The taxon fringillarius has more black in the face and is overall more rufescent (less ashy).

It is social and commonly seen in small groups. Unlike the "true" cowbirds in the genus Molothrus, this species is not a brood parasite. In contrast, the screaming cowbird is a brood parasite of the bay-winged cowbird, and while adult screaming cowbirds are overall blackish, juvenile screaming cowbirds closely resemble bay-winged cowbirds.

Habitat and status[edit]

It is found in a wide range of semi-open habitats, including scrub and light woodland. The north-eastern taxon fringillarius is primarily found in Caatinga and Cerrado. It is generally fairly common, and consequently considered to be of least concern by BirdLife International and IUCN.

References[edit]

  • Ridgely, R. S.; & Tudor, G. (1989). The Birds of South America vol. 1 - The Oscine Passerines. Oxford University Press. ISBN 0-19-857217-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!