Articles on this page are available in 2 other languages: Chinese (Simplified) (10), Dutch (1) (learn more)

Overview

Brief Summary

House martins like to nest against steep rocks. Although the Netherlands doesn't have much natural rock, house martins are very content here. Instead of rocky walls, they build their nests against houses. They make a ball from clay under the eaves, with the opening on the top. House martins often live in colonies. There can be dozens together during a good year. After nesting, all of the house martins migrate to Africa, returning again in April or May.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.458 - 12.984
  Nitrate (umol/L): 2.286 - 12.040
  Salinity (PPS): 31.635 - 35.345
  Oxygen (ml/l): 6.114 - 6.746
  Phosphate (umol/l): 0.273 - 0.653
  Silicate (umol/l): 1.963 - 7.673

Graphical representation

Temperature range (°C): 9.458 - 12.984

Nitrate (umol/L): 2.286 - 12.040

Salinity (PPS): 31.635 - 35.345

Oxygen (ml/l): 6.114 - 6.746

Phosphate (umol/l): 0.273 - 0.653

Silicate (umol/l): 1.963 - 7.673
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.458 - 12.984
  Nitrate (umol/L): 2.286 - 12.040
  Salinity (PPS): 31.635 - 35.345
  Oxygen (ml/l): 6.114 - 6.746
  Phosphate (umol/l): 0.273 - 0.653
  Silicate (umol/l): 1.963 - 7.673

Graphical representation

Temperature range (°C): 9.458 - 12.984

Nitrate (umol/L): 2.286 - 12.040

Salinity (PPS): 31.635 - 35.345

Oxygen (ml/l): 6.114 - 6.746

Phosphate (umol/l): 0.273 - 0.653

Silicate (umol/l): 1.963 - 7.673
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / guest
puparium of Crataerina hirundinis is a guest in nest of Delichon urbica
Other: major host/prey

Animal / associate
larva of Fannia parva is associated with nest of Delichon urbica

Animal / associate
larva of Fannia rondanii is associated with nest of Delichon urbica

Animal / parasite / ectoparasite / blood sucker
adult of Oeciacus hirundinis sucks the blood of nestling of Delichon urbica
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Delichon urbicum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCTGGAATAGTAGGTACCTCCCTTAGCCTGCTAATTCGAGCAGAACTCGGCCAGCCCGGGGCACTTCTCGGAGACGACCAAATTTATAACGTAATCGTCACGGCCCACGCCTTTGTAATAATTTTCTTCATAGTCATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCATTAATAATCGGCGCACCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTACTTCCTCCATCATTCCTGCTACTCCTAGCCTCCTCCACAGTAGAAGCAGGGGTGGGAACCGGCTGAACTGTATACCCACCCCTAGCCGGAAACCTGGCCCACGCTGGAGCCTCTGTAGACCTGGCTATCTTCTCCTTACACCTAGCAGGGATCTCCTCAATCCTAGGCGCAATCAATTTTATCACCACAGCAATCAACATAAAACCCCCCGCCCTATCACAATACCAAACACCCCTGTTCGTCTGATCGGTCCTAATCACTGCAGTACTTCTTCTCCTCTCTCTCCCAGTACTAGCCGCTGGTATCACCATGCTTCTTACAGACCGCAATCTAAACACTACCTTCTTCGACCCTGCTGGAGGAGGAGACCCAGTACTTTACCAACACCTGTTCTGATTCTTCGGCCACCCGGAAGTCTACATCCTAATCCTCCCAGGATTTGGAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Delichon urbicum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5