Overview

Comprehensive Description

General Description

This group of Dysstroma, consisting of D. citrata, suspectata, walkerata,and truncata, form a complex of species which are often difficult to distinguish without resorting to genitalic characters. D. citrata is usually the most common of the four, and generally flies later in the summer. It is smaller than walkerata, has a paler hindwing than suspectata, and poorly-defined, whitewashed forewing compared to truncata. The brown AM patch at the anal FW margin does not have a well-defined, round border as it does in truncata. The female genitalia are illustrated by McDunnough (1946), which are characterised by a distinctively large appendix bursa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

temperate Eurasia. In North America, found south to northern New England and across southern Canada; southern range limit in the west uncertain and the Pacific Northwest uncertain. (Forbes 1948, Wagner et al. 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Mesic deciduous and mixedwood forests and woodlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A variety of deciduous shrubs, especially alder (Alnus) and willow (Salix); also on western hemlock in B.C. (Prentice 1963). Larvae of this genus and other larentiines usually feed on herbaceous plants, for which specific host plant records are rare; the use of herbaceous plants by D. citrata may therefore be more widespread than the current records indicate.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

In Alberta the peak flight is from late July to mid August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Dysstroma citrata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 191
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Dysstroma citrata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 50 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGGTCTTTAATTGGGGACGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGTTACTCCCCCCTTCAATTACTCTTTTAATCTCAAGAAGTATCGTGGAAAGTGGAGCAGGAACTGGGTGAACTGTGTACCCCCCTCTTTCCTCAAATATTGCTCATGGTGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTCTAGGAGCTATTAATTTTATCACTACTATTATTAATATACGATTAAATAATATATTTTTTGACCAATTACCTTTATTTGTATGGGCCGTAGGAATCACAGCATTCTTACTTCTACTTTCATTACCAGTATTAGCAGGAGCTATTACCATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCCATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dysstroma citrata

The Dark Marbled Carpet or Northern Marbled Carpet (Dysstroma citrata) is a moth of the Geometridae family. It is found across the Holarctic ecozone. It has also been reported from India.

The wingspan is 25–32 mm. Adults are on wing from July to August in western Europe and North America.

The larvae feed on various shrubs and herbaceous plants, including Vaccinium species such as Vaccinium myrtillus and Vaccinium uliginosum as well as Aster tripolium, Alnus and Salix.

Subspecies[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!