Overview

Comprehensive Description

General Description

This group of Dysstroma, consisting of D. citrata, suspectata, walkerata,and truncata, form a complex of species which are often difficult to distinguish without resorting to genitalic characters. D. citrata is usually the most common of the four, and generally flies later in the summer. It is smaller than walkerata, has a paler hindwing than suspectata, and poorly-defined, whitewashed forewing compared to truncata. The brown AM patch at the anal FW margin does not have a well-defined, round border as it does in truncata. The female genitalia are illustrated by McDunnough (1946), which are characterised by a distinctively large appendix bursa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

temperate Eurasia. In North America, found south to northern New England and across southern Canada; southern range limit in the west uncertain and the Pacific Northwest uncertain. (Forbes 1948, Wagner et al. 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mesic deciduous and mixedwood forests and woodlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A variety of deciduous shrubs, especially alder (Alnus) and willow (Salix); also on western hemlock in B.C. (Prentice 1963). Larvae of this genus and other larentiines usually feed on herbaceous plants, for which specific host plant records are rare; the use of herbaceous plants by D. citrata may therefore be more widespread than the current records indicate.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

In Alberta the peak flight is from late July to mid August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  The larva is pale green with faint stripes, rolling its head under the thorax when disturbed; it rests in the typical geometrid pose, with the anterior part of the body raised at an angle above the substrate. The egg overwinters, unlike truncata which overwinters as a mature larva and consequently appears earlier in the spring (Wagner et al. 2001). Adults come to light and also sugar bait (Ferguson 1954).  
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dysstroma citrata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 50 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGGTCTTTAATTGGGGACGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGTTACTCCCCCCTTCAATTACTCTTTTAATCTCAAGAAGTATCGTGGAAAGTGGAGCAGGAACTGGGTGAACTGTGTACCCCCCTCTTTCCTCAAATATTGCTCATGGTGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTCTAGGAGCTATTAATTTTATCACTACTATTATTAATATACGATTAAATAATATATTTTTTGACCAATTACCTTTATTTGTATGGGCCGTAGGAATCACAGCATTCTTACTTCTACTTTCATTACCAGTATTAGCAGGAGCTATTACCATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCCATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dysstroma citrata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 191
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dysstroma citrata

The Dark Marbled Carpet or Northern Marbled Carpet (Dysstroma citrata) is a moth of the Geometridae family. It is found across the Holarctic ecozone. It has also been reported from India.

The wingspan is 25–32 mm. The ground colour of the forewings may show whitish, grey, black or brown tints but the colour is extremely variable and there are strongly darkened forms. Characteristic is the protruding post medial line on the front wings, which usually reaches the post discal wavy line or interrupts it. Very similar to Dysstroma truncata. [1]

Adults are on wing from July to August

It is found from Europe through the temperate zone of Asia through Northwest China, Mongolia to the Russian Far East and Japan. It is absent in Portugal, on the Mediterranean islands and Greece. In the North, it occurs in Scandinavia up to Lapland and Iceland and the Faroe Islands.In North America it is found from Alaska and Newfoundland to New England and California.It is also reported in India.

It has been found at a height of about 2,400 metres in the Alps. It prefers mountainous areas, wetlands, mountain forests and bushy slopes.

The larvae feed on various shrubs and herbaceous plants, including Vaccinium species such as Vaccinium myrtillus and Vaccinium uliginosum as well as Aster tripolium, Alnus and Salix.

Subspecies[edit]

References[edit]

  1. ^ Fritz Heydemann, 1930 Zur D. truncata Hfn.-citrata Frage. , Zeitschrift des österreichischen Entomologischen Vereins, Wien, 1930
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!