Articles on this page are available in 2 other languages: Spanish (2), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Argyropelecus hemigymnus ZBK Cocco, 1829

Aegean Sea : 5000-90 (1 spc.), 24.01.1969 , Goekova Bay , 430 m, M. Demir .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Oceanic (Ref. 4739) and mesopelagic, mainly at 250-650 m (Ref. 4054). Depth range from 100-700 m (Ref. 4462) and from 460-1082 m in the eastern Ionian Sea (Ref. 56504). Adults make marked vertical migrations (Ref. 4739). Found singly or in small groups (Ref. 4739). An opportunistic feeder at dusk on calanoid copepods, small fishes, etc (Ref. 4739). Sexual dimorphism with regard to body size (Ref. 5168), the males being slightly smaller than the females (Ref. 8966). Oviparous, with planktonic eggs and larvae (Ref. 35838).Occurs between 200 and 700 m depth during the day, concentrated between 350 and 550 m, and between 100 and 650 m at night, preferring a depth between 150 and 380 m Ref. 47377). Also Ref. 58302.
  • Gon, O. 1990 Sternoptychidae. p. 123-126. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

References

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Messina, Sicily, Italy, Mediterranean Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type specimen(s)

No types known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Main Reference

Baird RC. 1971. The Systematics, Distribution, and Zoogeography of the Marine Hatchetfishes (family Sternoptychidae). Bulletin of the Museum of Comparative Zooology 142(1):1–128.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Dorsal-fin rays 8; anal-fin rays 11; pectoral-fin rays 10–11; total gill rakers (rarely 18) 19–23 (rarely 24); vertebrae (rarely 36) 37–38. Dwarf species rarely exceeding 38 mm SL; trunk very long and narrow; its depth at origin of anal photophores three or more times into greatest body depth, subcaudal photophores well separated from anals; dorsal spine medium-to-high, its height often exceeds its length; post-temporal spines well developed; postabdominal spines fused to form a single spine complex; lower preopercle spine directed ventrally, the upper posterio-dorsally; jaws medium; teeth small to minute; gill rakers long and numerous; in preservative abdominal region dark, trunk pigmentless except in definite patches along midline and above anal and subcaudal photophore groups.

Two pigment forms designated form "A" and form "B" occur over much of the species range. Form A is characterized by distinct and clearly defined body pigmentation, while in form B, the body pigmentation is quite diffuse. This pigment difference is not a function of size or sex, is intermediate in few individuals, and both forms do occur syntopically. A morphometric analysis of three sympatric populations in several characters and meristics, plus measurements from one or the other pigment forms from other areas by Baird (1971) failed to show any significant difference between sympatric populations. In addition, there was no consistent sorting out over the range of variability of any one form in any character. Analysis of diurnal depth distributions revealed a marked sorting out of pigment types with the A form most numerous during the day while the B form was predominantly caught at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Grand Bank, into the Gulf of Mexico and in the Caribbean Sea
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Half-naked Hatchetfish (Argyropelecus hemigymnus) is distributed through the eastern Pacific, and both the eastern and western Atlantic Ocean. In the eastern Atlantic, it is found from north of the British Isles to South Africa; in the western Atlantic it is found from New Jersey, USA to Argentina. In the Pacific it occurs throughout the California Current area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: north of British Isles to South Africa, including western Mediterranean. Western Atlantic: New Jersey, USA to Argentina (Ref. 26340). Northwest Atlantic: Canada (Ref. 5951). Eastern Pacific: throughout the California Current area, seaward of the continental shelf (Ref. 35838). Known from tropical and subtropical waters of all oceans (Ref. 47377). South China Sea (Ref.74511).
  • Gon, O. 1990 Sternoptychidae. p. 123-126. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in the South Atlantic around the Falkland Islands and abundantly off the southeast coast of Brazil; a scattering of catches along latitude 35° S to the Cape of Good Hope suggests a broad distribution across the South Atlantic; occurs in small catches along the southwest African coast, appears absent in the Gulf of Guinea, but occurs in the western tropical Atlantic; is taken in moderate numbers in the Caribbean and Gulf of Mexico and abundantly in the western Atlantic; is abundant across the North Atlantic and the eastern North Atlantic as far south as the Cape Verdes Islands; it represents the only species of this family in the Mediterranean, where it occurs abundantly in the western basin; scattered moderate-to-small catches are present from to 12°S latitude in the central Indian Ocean, and another population is scattered from 20° S to 40° S with several small catches reported from the southeastern and southwestern Indian Ocean; a single catch off the Philippines, another at 42°N, I69°E, and small catches from the Banda Sea and near Hawaii represent this species in the west and central Pacific; large populations occur off California and Chile; it is taken abundantly across the Southern Ocean from 35°– 55°S latitude from Chile to New Zealand; taken in small numbers in the Tasman Sea and off Sidney, Australia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical, subtropical and temperate seas (including Mediterranean Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8 - 9; Analspines: 0; Analsoft rays: 11 - 12; Vertebrae: 36 - 39
  • Watson, W. 1996 Sternoptychidae: hatchetfishes. p. 268-283. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. Allen Press, Inc., Lawrence, Kansas. 1505 p. (Ref. 35838)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 39 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.9 cm SL (male/unsexed; (Ref. 4462)); 3.9 cm SL (female); max. reported age: 1 years (Ref. 5168)
  • Gon, O. 1990 Sternoptychidae. p. 123-126. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rarely exceeds about 40 mm SL.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body bright silvery in color; body and trunk with dusky coloration at night (Ref. 4054). Branchiostegal rays: 10 (Ref. 35838).
  • Watson, W. 1996 Sternoptychidae: hatchetfishes. p. 268-283. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. Allen Press, Inc., Lawrence, Kansas. 1505 p. (Ref. 35838)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Differs from all other species in genus Argyropelecus by its narrow trunk, single postabdominal spine, small size, minute teeth, presence of only eight dorsal and eleven anal rays.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Argyropelecus hemigymnus
Catalog Number: USNM 51632
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: Lae-O Ka Laau Light, Molokai Island, S. 34 Degrees 30', E. 12.3', Kaiwi Channel, Between Molokai and Oahu Islands, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 640 to 649
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mesopelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Found at depths of 250- 650 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Half-naked Hatchetfish is a bathypelagic species which occurs at depths of up to 2,400 m. During the day this species occurs at a depth range of 200 - 700 m but is concentrated at 350 - 550 m. At night it occurs at depths of 100 - 650 m but prefers a depth range of 150 - 380 m. Adults make daily vertical migrations up the water column, rising at dusk to feed on copepods and small fish. It will spawn multiple times during a season, producing planktonic eggs.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 0 - 2400 m (Ref. 74511), usually 250 - 600 m (Ref. 4054)
  • Weitzman, S.H. 1986 Sternoptychidae. p. 253-259. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4054)
  • Yang, J., Z. Huang, S. Chen and Q. Li 1996 The Deep-Water Pelagic Fishes in the Area form Nansha Islands To the Northeast part of South China Sea. Science Publication Company, Beijing. 190 pp. (Ref. 74511)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 472 specimens in 1 taxon.
Water temperature and chemistry ranges based on 431 samples.

Environmental ranges
  Depth range (m): 0 - 4000
  Temperature range (°C): 1.433 - 24.424
  Nitrate (umol/L): 0.378 - 43.861
  Salinity (PPS): 33.807 - 38.522
  Oxygen (ml/l): 0.395 - 7.761
  Phosphate (umol/l): 0.178 - 3.269
  Silicate (umol/l): 1.222 - 141.240

Graphical representation

Depth range (m): 0 - 4000

Temperature range (°C): 1.433 - 24.424

Nitrate (umol/L): 0.378 - 43.861

Salinity (PPS): 33.807 - 38.522

Oxygen (ml/l): 0.395 - 7.761

Phosphate (umol/l): 0.178 - 3.269

Silicate (umol/l): 1.222 - 141.240
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs from 200 m to 700 m by day with the greatest concentration between 350– 550 m; occurs from 100 m to 650 m by night with concentrations between 150–380 m; tropical submergence indicated in the Gulf and Caribbean by examining number of catches above 200 m compared with the North Atlantic; by day it appears to concentrate at about 550 m in the Sargasso Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 700m.
From 100 to 700 meters.

Habitat: bathypelagic. Mesopelagic, mainly in 250-650 m (Ref. 4054). Adults makes marked vertical migrations. Submersible observations: actively swimming, horizontally oriented, singly or in small groups. An opportunistic feeder at dusk on calanoid copepods, small fishes, etc. Dioecious, both sexes apparently mature at about 1 year old. Dies shortly after spawning. Eggs measure 0.9-1.0 mm in diameter. A single oil globule (Ref. 5168). Sexual dimorphism with regard to body size (Ref. 5168), the males being slightly smaller than the females (Ref. 8966).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic (Ref. 4739) and mesopelagic, mainly at 250-650 m (Ref. 4054). Occur between 200 and 700 m depth during the day, concentrated between 350 and 550 m, and between 100 and 650 m at night, preferring a depth between 150 and 380 m (Ref. 47377). Adults make marked vertical migrations (Ref. 4739). Found singly or in small groups (Ref. 4739). An opportunistic feeder at dusk on calanoid copepods, small fishes (Ref. 4739).
  • Hopkins, T.L. and R.C. Baird 1985 Feeding ecology of four hatchetfishes (Sternoptychidae) in the eastern Gulf of Mexico. Bull. Mar. Sci. 36(2):260-277. (Ref. 13803)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on copepods and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawns more than once per season with egg batches about 50-500 egg/ovary pair, the number increasing with increased animal size (Ref. 4739).
  • Badcock, J. 1984 Sternoptychidae. p. 302-317. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 1. UNESCO, Paris. (Ref. 4739)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Argyropelecus hemigymnus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACTTGGTGTTTGGTGCCTGAGCCGGAATAGTGGGCACTGCTCTAAGCCTGCTCATTCGAGCCGAGCTAAGCCAGCCCGGCGCCCTTATGGGCGACGACCAAATCTACAATGTCATCGTCACAGCACACGCCTTTGTAATAATCTTCTTTATGGTCATACCCATTATAATTGGCGGCTTTGGAAATTGACTAATCCCCCTAATAATTGGCGCCCCAGACATAGCCTTTCCCCGAATAAACAACATAAGCTTTTGACTTCTTCCCCCCTCATTCCTTCTTCTACTTGCCTCCTCTGGCGTCGAAGCGGGGGCAGGGACTGGCTGAACCGTCTACCCTCCCCTCTCTAGCAACCTTGCGCACGCAGGAGCCTCCGTTGATCTAACTATCTTTTCACTTCACCTTGCAGGGATCTCCTCTATCTTAGGGGCAATTAACTTCATCACTACAATCACCAACATGAAGCCCCCAGCAGTCTCCCAACACCAAACACCCCTTTTCGTATGATCCGTCCTCATTACGGCAGTTCTCCTCCTTCTATCCCTACCTGTGCTAGCTGCCGGCATCACCATACTCCTAACGGACCGGAATTTGAACACTACCTTTTTTGACCCTGCCGGAGGGGGAGACCCCATTCTCTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Argyropelecus hemigymnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Harold, A.S.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
The Half-naked Hatchetfish, Argyropelecus hemigymnus, has been assessed as Least Concern. This species has a wide global distribution and is not known to face any major threats due to its deepwater nature. In addition there is no dorected commercial fishery due to its small size and the depths at which it is found. The population numbers are likely to be stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Due to its deep-water nature and small size, it is unlikely that this species is being impacted upon by any major threat processes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place, or needed, for the Half-naked Hatchetfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Weitzman, S.H. 1986 Sternoptychidae. p. 253-259. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4054)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Argyropelecus hemigymnus

Messina Straits Argyropelecus hemigymnus.jpg

Argyropelecus hemigymnus, the half-naked hatchetfish, short silver hatchetfish or spurred hatchetfish, is a deep-sea hatchetfish of the genus Argyropelecus found in mesopelagically in all oceans. It is a small species rarely exceeding 38 millimetres (1.5 in) standard length.[1] It feeds on zooplankton, particularly ostracods and copepods.[2][3] Sexual maturation occurs at length of about 22 mm, and adult males have more developed olfactory organs than females, i.e. the species is sexually dimorphic.[4]

References[edit]

  1. ^ Baird, R. C. (1971). "The systematics, distribution, and zoogeography of the marine hatchetfishes (family Sternoptychidae)". Bulletin of The Museum of Comparative Zoology 142: 1–128. 
  2. ^ Merrett, N. R.; Roe, H. S. J. (1974). "Patterns and selectivity in the feeding of certain mesopelagic fishes". Marine Biology 28 (2): 115. doi:10.1007/BF00396302.  edit
  3. ^ Hopkins, Thomas L.; Ronald C. Baird (1985). "Feeding ecology of four hatchetfishes (Sternoptychidae) in the eastern Gulf of Mexico". Bulletin of Marine Science 36 (2): 260–277. 
  4. ^ Baird, R. C.; G. Y. Jumper; E. E. Gallaher (1990). "Sexual dimorphism and demography in two species of oceanic midwater fishes (Stomiiformes: Sternoptychidae) from the eastern Gulf of Mexico". Bulletin of Marine Science 47: 561–566. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!