Molecular Biology and Genetics

Molecular Biology

Barcode data: Chloroclysta siterata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATTTTATTTTTGGTATTTGAGCAGGTATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCCGGCTCTTTAATTGGAGATGACCAAATTTACAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTCCCCCCCTCAATTACACTTTTAATTTCCAGAAGTATTGTAGAAAATGGAGCAGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGCACATGGAGGAAGATCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCCTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACCATACTATTAACTGATCGTAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCCATCCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chloroclysta siterata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chloroclysta siterata

The Red-green Carpet (Chloroclysta siterata) is a moth in the family Geometridae.

Distribution[edit]

Palearctic most of Europe to central Asia.

Description[edit]

The wingspan is 28–36 mm.The ground colour of the forewings are is greyish green, with a reddish tinge.The central band is dark and may be replaced by dark wavy cross lines.The forewings have a pointed shape. This is a very variable species.

Similar Species: Adults are similar in appearance to the Autumn Green Carpet Chloroclysta miata but C. miata has a pale central band, grey hindwings and no red tinge.

Biology[edit]

The larva feeds on Populus tremula, Salix caprea, Quercus robur, Quercus petraea, Quercus rubra, Chaenomeles japonica, Sorbus aucuparia, Rosa canina, Rosa vosagiaca, Prunus serrulata, Acer pseudoplatanus, Frangula alnus, Tilia (Linden )

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!