Overview

Comprehensive Description

Biology

Occurs in shallow lagoon and seaward reefs, in areas of mixed coral, rock or sand. Juveniles mimic the cryptic Centropyge eibli (Ref. 9710, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Acanthurus tristis is found from the Andaman Sea, southern Indonesia to the Maldive Islands and Chagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: Bay of Bengal (Ref. 8940) and the Andaman Sea west to Maldives and Chagos Archipelago, and east to islands of southern Indonesia at least to Bali.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 23 - 33; Analsoft rays: 22 - 29
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Margin of caudal fin narrow and white. No orange area behind gill opening and extending ventrally behind base of pectoral fins (juveniles mimic the angelfish Centropyge eibli) (Ref 9808).
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Acanthurus tristis occurs on shallow lagoon and seaward reefs, in areas of mixed coral, rock or sand. It generally occurs in deeper and more sheltered waters, frequently over sand and rubble bottoms (J.H. Choat pers. comm. 2010). It is classified as a detritivore (Choat and Beood pers. obs. in Green and Bellwood 2009). The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010). Juveniles of this species resemble Centropyge eibli (Kuiter and Debelius 1994).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 26m.
From 2 to 26 meters.

Habitat: reef-associated. Occurs in shallow lagoon and seaward reefs, in areas of mixed coral, rock or sand (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 26 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTCGGTGCTTGAGCCGGAATAGTAGGAACAGCACTAAGCCTCCTGATCCGAGCAGAACTAAGTCAACCAGGCGCCCTCCTAGGGGATGATCAAATTTATAATGTAATCGTCACGGCACACGCATTCGTAATAATTTTCTTTATGGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAATCCCTCTAATGATTGGGGCTCCCGACATGGCGTTTCCACGAATAAACAATATGAGCTTTTGACTTCTTCCCCCATCTTTCCTACTTCTCCTTGCTTCATCTGGTGTAGAGTCTGGGGCGGGAACGGGCTGGACGGTTTATCCCCCTTTAGCGGGCAATCTTGCACATGCCGGAGCCTCTGTAGATCTTACTATCTTTTCCCTTCATCTTGCAGGAATTTCCTCAATTCTTGGGGCTATTAATTTTATTACAACAATCATTAATATGAAACCCCCTGCTATTTCTCAGTACCAAACACCCCTATTCGTATGAGCAGTACTAATTACTGCCGTCCTACTCCTTCTCTCACTCCCTGTCCTGGCCGCTGGCATTACAATGTTATTAACTGATCGAAATCTAAACACTACTTTCTTTGACCCTGCTGGAGGTGGAGATCCTATTCTCTACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
McClenachan, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus tristis is found in the eastern Indian Ocean. It is rare in parts of its range and can be common but not abundant in parts of its distribution (Bali). Juveniles are a minor component of the aquarium trade in Sri Lanka and it is incidentally captured for food. Harvesting is not considered to be a threat at present time and its distribution overlaps with marine protected areas in parts of its range. It is therefore listed as Least Concern. We recommend monitoring of the harvest levels and population status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Acanthurus tristis is rare in the Seychelles, Christmas and Cocos Islands (J.H. Choat pers. comm. 2010). It is common in Bali, Indonesia, but not abundant (L. Rocha pers. comm. 2010). This species is a target reef fish in western Thailand. One hundred and twenty-four individuals were recorded from 14 sites off the western coast of Thailand, four months after the Sumatran tsunami disaster (Allen 2005).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Acanthurus tristis

Acanthurus tristis is a Tang from the Indian Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 25 cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!