Overview

Comprehensive Description

Biology

Occurs in shallow lagoon and seaward reefs, in areas of mixed coral, rock or sand. Juveniles mimic the cryptic Centropyge eibli (Ref. 9710, 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indian Ocean: Bay of Bengal (Ref. 8940) and the Andaman Sea west to Maldives and Chagos Archipelago, and east to islands of southern Indonesia at least to Bali.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 23 - 33; Analsoft rays: 22 - 29
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Margin of caudal fin narrow and white. No orange area behind gill opening and extending ventrally behind base of pectoral fins (juveniles mimic the angelfish Centropyge eibli) (Ref 9808).
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 2 - 26m.
From 2 to 26 meters.

Habitat: reef-associated. Occurs in shallow lagoon and seaward reefs, in areas of mixed coral, rock or sand (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 26 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTCGGTGCTTGAGCCGGAATAGTAGGAACAGCACTAAGCCTCCTGATCCGAGCAGAACTAAGTCAACCAGGCGCCCTCCTAGGGGATGATCAAATTTATAATGTAATCGTCACGGCACACGCATTCGTAATAATTTTCTTTATGGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAATCCCTCTAATGATTGGGGCTCCCGACATGGCGTTTCCACGAATAAACAATATGAGCTTTTGACTTCTTCCCCCATCTTTCCTACTTCTCCTTGCTTCATCTGGTGTAGAGTCTGGGGCGGGAACGGGCTGGACGGTTTATCCCCCTTTAGCGGGCAATCTTGCACATGCCGGAGCCTCTGTAGATCTTACTATCTTTTCCCTTCATCTTGCAGGAATTTCCTCAATTCTTGGGGCTATTAATTTTATTACAACAATCATTAATATGAAACCCCCTGCTATTTCTCAGTACCAAACACCCCTATTCGTATGAGCAGTACTAATTACTGCCGTCCTACTCCTTCTCTCACTCCCTGTCCTGGCCGCTGGCATTACAATGTTATTAACTGATCGAAATCTAAACACTACTTTCTTTGACCCTGCTGGAGGTGGAGATCCTATTCTCTACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus tristis

Acanthurus tristis is a Tang from the Indian Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 25 cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!