Overview

Comprehensive Description

Abudefduf saxatilis (Linnaeus 1758)

Materials

Type status: Other material. Occurrence: catalogNumber: CIRR-284 ; recordedBy: Salvador Zarco Perello ; individualCount: 2 ; Location: continent: America; country: Mexico ; stateProvince: Yucatan; locality: Madagascar Reef ; verbatimDepth: 5 m; verbatimLatitude: 782271.440297; verbatimLongitude: 2373332.34712; verbatimCoordinateSystem: UTM 15N; verbatimSRS: WGS84; decimalLatitude: 21.440307 ; decimalLongitude: -90.276681 ; Event: samplingProtocol: Photosampling ; eventDate: 8/10/2007 ; Record Level: collectionID: YUC-PEC_239-01-64; institutionCode: UMDI-SISAL ; collectionCode: CIRR

Distribution

Western Atlantic. North Carolina to Brazil. Including Bermuda, Bahamas and throughout the Caribbean Islands.

  • Zarco Perello, Salvador, Moreno Mendoza, Rigoberto, Simoes, Nuno (2014): Checklist of Fishes from Madagascar Reef, Campeche Bank, Mexico. Biodiversity Data Journal 2, 1100: 1100-1100, URL:http://dx.doi.org/10.3897/BDJ.2.e1100
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Juveniles are common in tide pools while adults found over shallow reef tops. Adults frequently form large feeding aggregations of up to several hundred individuals. Food items include algae, small crustaceans and fish, and various invertebrate larvae (Ref. 3139). At Fernando de Noronha Archipelago, this species feeds on spinner dolphins’ feces and vomits. The offal feeding may be regarded as a simple behavioral shift from plankton feeding to drifting offal picking. Also, juveniles may hold cleaning stations together with the doctorfish (Acanthurus chirurgus) and the blue tang (Acanthurus coeruleus) and graze algae as well as pick molted skin and parasites from green turtles (Chelonia mydas ). This behavior is preceded by a characteristic inspection usually followed by feeding nips on the turtles’ skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Ref. 48727, 51385). Adult males adopt a bluish ground color when guarding eggs. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Attracted to divers who feed fish. Marketed fresh (Ref. 3139). Has been reared in captivity (Ref. 35420).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abudefduf saxatilis is a member of the pomacentridae family that includes both the damselfishes and anemonefishes. This family is abundant in the tropical and warm temperate waters of the world. The Seargeant major is a small, laterally compressed rounded fish. There is a single nostril on either side of the snout distinguishing it from the butterflyfishes and angelfishes. It has a small, oblique terminal mouth. The upper part of the body is yellowish with 5 vertical black bars. Sometimes a faint sixth bar can be present. There is a black spot at the upper base of the pectoral fin (Randall 1996). A. saxatilis is often observed on shallow reefs in large feeding aggregations of up to a few hundred individuals (Randall 1996). This fish uses different color phases for camouflage. The light phase is visible from below when the sergeant major is swimming over the reef, while the dark phase allows the fish to hide in the reef in response to danger. When males guard the red or purple patches of eggs in their nests they become dark bluish (Randall 1996).
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic Ocean: 40.9°N to Uruguay in the western Atlantic, abundant on Caribbean reefs; around islands of the mid-Atlantic, Cape Verde, and along the tropical coast of western Africa south to Angola
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic Ocean: Canada (Ref. 5951) to Rhode Island, USA to Uruguay in the western Atlantic, abundant on Caribbean reefs; around islands of the mid-Atlantic, Cape Verde, and along the tropical coast of western Africa south to Angola. This species is strictly an Atlantic species. It is replaced in the Indo-Pacific region by the closely related Abudefduf vaigiensis (G. Allen, pers. comm.).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abudefduf saxatilis is abundant in reef and rocky environments in the Atlantic ocean (Molina et al. 2006). Populations have been recorded in the western Atlantic ocean from as far north as Canada to Uruguay in South America at depths ranging from 0 to 20 m. A. saxatilis is abundant on Caribbean reefs (Randall 1996) and on the tropical coast of western Africa to Angola where they form large feeding aggregations of up to a few hundred individuals. Juveniles are found in tide pools or in protected areas schooling close to caves and shipwrecks. Adults are most common on shallow reefs. Juveniles of Abudefduf saxatilis were recorded as one of the ten most abundant species of fish occurring in the surveys in the Indian River Lagoon (Lindemen and Snyder 1999).
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan (possibly only Atlantic).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 10 - 12
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 229 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.9 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 200 g (Ref. 5288)
  • Edwards, A. 1990 Fish and fisheries of Saint Helena Island. Centre for Tropical Coastal Management Studies, University of Newcastle upon Tyne, England. (Ref. 5288)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Abudefduf saxatilis grows to a maximum length of approximately 23 cm and can weigh up to 0.2 kg. Males and females reach maturity at 10 cm and 8 cm, respectively.
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Damselfishes with 13 dorsal-fin spines indicate Abudefduf as well as the deep-water Chromis enchrysura, C. insolata, and C. scotti. Abudefduf saxatilis have a mode of 13 dorsal-fin soft rays and 12 anal-fin soft rays (D-XIII,13 A-II,11-12 Pect-18-19). A. taurus have fewer median-fin soft rays, with a mode of 12 dorsal-fin soft rays and 10 anal-fin soft rays (D-XIII,12 A-II,10 Pect-18-19). The Chromis species have modes of 12/11 or 12/12. (ML)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Usually found in shallow waters to around 15 meters, juveniles are common in tide pools while adults school over shallow reeftops. Adults frequently form large feeding aggregations of up to several hundred individuals. Food items include algae, small crustaceans and fish, and various invertebrate larvae. Adult males adopt a bluish ground colour when guarding eggs. Attracted to divers who feed fish. Generally common (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Greenish yellow above, shading to white below, with 5 prominent vertical black bars that narrow toward belly (Ref. 26938). A faint sixth bar may be present posteriorly on caudal peduncle; a black spot at upper base of pectoral fin. The adult male becomes dark bluish, the black bars thus less conspicuous on the body (Ref. 13442).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Abudefduf saxatilis
Catalog Number: USNM 42316
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Brown
Year Collected: 1890
Locality: Ascension or St. Helena, Ascension Island, Atlantic
  • Paratype: Fowler, H. W. 1919. Proceedings of the United States National Museum. 56 (2294): 218, 4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Abudefduf saxatilis
Catalog Number: USNM 42315
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): A. Brown
Year Collected: 1890
Locality: Ascension Island., Ascension Island, Atlantic
  • Holotype: Fowler, H. W. 1919. Proceedings of the United States National Museum. 56 (2294): 218, 4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Abudefduf saxatilis
Catalog Number: USNM 42314
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Brown
Year Collected: 1890
Locality: Ascension Island., Ascension Island, Atlantic
Vessel: Eclipse
  • Paratype: Fowler, H. W. 1919. Proceedings of the United States National Museum. 56 (2294): 218, 4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Abudefduf saxatilis
Catalog Number: USNM 273309
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Brown
Year Collected: 1890
Locality: Ascension Island., Ascension Island, Atlantic
Vessel: Eclipse
  • Paratype: Fowler, H. W. 1919. Proceedings of the United States National Museum. 56 (2294): 218, 4.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Abudefduf sexfasciatus (Lac?pde 1801) Abudefduf septemfasciatus (Cuvier) Abudefduf vaigiensis (Quoy and Gaimard 1825)
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adults frequently form large feeding aggregations of up to several hundred individuals.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 0 - 20 m (Ref. 58047)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 206 specimens in 1 taxon.
Water temperature and chemistry ranges based on 82 samples.

Environmental ranges
  Depth range (m): 0 - 274
  Temperature range (°C): 15.839 - 29.003
  Nitrate (umol/L): 0.094 - 14.710
  Salinity (PPS): 32.019 - 37.169
  Oxygen (ml/l): 3.453 - 4.940
  Phosphate (umol/l): 0.051 - 1.177
  Silicate (umol/l): 0.868 - 15.721

Graphical representation

Depth range (m): 0 - 274

Temperature range (°C): 15.839 - 29.003

Nitrate (umol/L): 0.094 - 14.710

Salinity (PPS): 32.019 - 37.169

Oxygen (ml/l): 3.453 - 4.940

Phosphate (umol/l): 0.051 - 1.177

Silicate (umol/l): 0.868 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits inshore and offshore coral or rocky reefs (Ref. 7247). Juveniles are common in tide pools while adults found over shallow reef tops. Adults frequently form large feeding aggregations of up to several hundred individuals. It feeds primarily as a browsing herbivore (Ref. 275). Food items include algae, small crustaceans and fish, and various invertebrate larvae (Ref. 3139). Feeds on spinner dolphins’ feces and vomits at Fernando de Noronha Archipelago, southeast Atlantic. The offal feeding may be regarded as a simple behavioral shift from plankton feeding to drifting offal picking. Also, juveniles hold cleaning stations together with the doctorfish (Acanthurus chirurgus) and the blue tang (Acanthurus coeruleus) and graze algae as well as pick molted skin and parasites from green turtles (Chelonia mydas ). This behavior is preceded by a characteristic inspection usually followed by feeding nips on the turtles’ skin (head, limbs, and tail), as well as on the carapace. The most inspected and cleaned body parts are the flippers (Ref. 48727, 51385).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847. (Ref. 33)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Seargeant major feeds on an unusually wide variety of benthic algae, small crustaceans, colonial anemones, copepods, pelagic tunicates, invertebrate larvae, and small fishes (Randall 1996).
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Juvenile Abudefduf saxatilis may take part at cleaning stations for the sea turtle Chelonia mydas with the doctorfish, Acanthurus chirurgus, and the blue tang, Acanthurus coeruleus. These fish inspect the hard shell and the soft tissues of the removing algae and parasites.
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Abudefduf saxatilis is abundant on tropical reefs and has been observed to rapidly increase its population size in areas of recreational disturbance where artificial food sources are created by fish feeding and habitat disturbances (Medieros et al. 2007).
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Food items include algae, small crustaceans and fish, and various invertebrate larvae
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sergeant majors are oviparous. Males prepare nests for egg masses on rocks, reef outcrops, shipwrecks, and pilings. Spawning times vary depending upon region. For example, Caribbean populations do not appear to exhibit a lunar spawning pattern. Females in this region have been observed to spawn at various times throughout the month (Foster 2004). During courtship males actively chase females in the early hours of the day and spawning takes place in the morning hours. Approximately 200,000 salmon or red colored, oval shaped eggs measuring 0.5 to 0.9 mm in diameter are released in discrete, densely packed monolayers that adhere to the substratum (Robertson et al. 1993). Once fertilized the eggs turn greenish (with 96 hours). The male guards the eggs until they hatch usually within 4-5 days after fertilization in the hour following sunset (Robertson et al. 1993, Foster 2004).
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Abudefduf saxatilis larvae have a reduced pelagic stage lasting 18-27 days and a post larval pelagic stage lasting 55 days (Molina et al. 2006). The egg and larval development of laboratory-reared A. saxatilis has been exhaustively described by Alshuth et al. (1998). This study identified pigmentation, pelvic fin size, and the pectoral fin rays as the most useful characteristics for identifying the larvae of A. saxatilis from the yellowtail damselfish Microspathodon chrysurus and beaugregory Stegastes leucostictus. The sergeant major larva has a smaller and less pigmented fin and more heavily pigmented dorsal and pelvic fins.
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf saxatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACAGCCCTGAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAGATTTACAACGTAATTGTTACGGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAACTGACTTATCCCACTAATGATCGGTGCCCCTGATATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTTCCCCCATCGTTCCTACTTCTTCTTGCCTCCTCCGGAGTTGAAGCAGGTGCAGGAACAGGCTGAACTGTCTACCCACCACTATCAGGCAACCTAGCTCACGCAGGAGCTTCTGTTGACTTAACTATTTTCTCCCTCCACTTAGCAGGTGTGTCCTCAATTTTAGGAGCCATTAATTTTATTACCACTATTATTAATATGAAACCTCCAGCTATTTCTCAATACCAGACTCCTCTCTTCGTATGAGCCGTACTCATCACGGCCGTGCTCCTCCTTCTGTCCCTTCCTGTTTTAGCCGCTGGAATTACGATACTTCTAACCGACCGAAACTTAAATACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCCATTCTTTACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Abudefduf saxatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Baensch, H.A. 1992 Neue Meerwasser-Praxis. Tetra Verlag, Melle, Germany. (Ref. 7309)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sergeant major are popular in the aquarium trade.
  • Alshuth SR, Tucker JW, and J Hateley. 1998. Egg and larval development of laboratory-reared sergeant major, Abudefduf saxatilis (Pisces, Pomacentridae). Bulletin of Marine Science 62:121-133.
  • Fish Base (a). Abudefduf saxatilis Seargeant major. Species summary. Available online.
  • Fish Base (b). Abudefduf saxatilis Seargeant major. Synonymy. Available online.
  • FMNH. Ichthyology at the Florida Museum of Natural History. Available online.Foster SA. 2004. Diel and lunar patterns of reproduction in the Caribbean and Pacific sergeant major damselfishes Abudefduf saxatilis and A. troschelii. Marine Biology 95:333-343.
  • ITIS. Integrated Taxonomic Information System. Available online.
  • Lindeman KC and DB Snyder. 1999. Nearshore hardbottom fishes of southeast Florida and effects of habitat burial caused by dredging. Fisheries Bulletin 97:508-525.
  • Medeiros PR, Grempel RG, Souza AT, Ilarri MI, and CLS Sampaio. 2007. Effects of recreational activities on the fish assemblage structure in a northeastern Brazilian reef. Pan-American Journal of Aquatic Sciences 2:288-300.
  • Molina WF, Shibatta OA, and PM Galetti, Jr. 2006. Multivariate morphological analyses in continental and island populations of Abudefduf saxatilis (Linneaeus) (Pomacentridae, Perciformes) of western Atlantic. Panama-American Journal of Aquatic Science 1:49-56.
  • Randall JE. 1996. Caribbean Reef Fishes, Third Edition, TFH Publications, Neptune City, NJ. 512 p.
  • Robertson DR, Schober UM, and JD Brawn. 1993. Comparative variation in spawning output and juvenile recruitment of Caribbean reef fishes. Marine Ecology Progress Series 94:105-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sergeant major (fish)

School of sergeant majors, Jamaica

The sergeant major or píntano (Abudefduf saxatilis, family Pomacentridae) is a large, colourful damselfish. It earns its name from its brightly striped sides, which are reminiscent of the insignia of a military sergeant major. It grows to a length of about 15 cm (6 in).

The fish feed upon the larvae of invertebrates, zooplankton, smaller fish, crustaceans, and various species of algae. They are preyed upon by some members of the Labridae and Serranidae families. They lay their eggs in patches on a firm substrate and guard them vigorously until they hatch. The males will turn a sky blue during this period.

Sergeant majors are found throughout the tropical reaches of the Atlantic, including off the south coast of the United States, Central America, eastern South America, including the island Bonaire and western Africa. They are often found on coral reefs at depths between one and 12 meters.

They are popular aquarium fish, although their aggressively territorial nature can pose problems if not closely watched.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!