Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Scopula submutata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Scopula submutata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTCTTACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCTCCTTTATCTTCAAATATTGCTCATGGTGGTAGATCTGTAGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATCATTTGACCAATTACCATTATTCGTTTGAGCTGTTGGAATTACTGCATTTTTACTTTTATTATCTTTACCTGTTTTAGCTGGAGCCATTACTATATTACTTACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Scopula submutata

The Mediterranean Lace Border (Scopula submutata) is a moth of the Geometridae family. It is found in southern Europe,[2] North Africa and the Near East. The habitat consists of open, dry grassland and rocky slopes.

The wingspan is 20–25 mm. There are two generations per year, with adults on wing from May to October.[3]

The larvae feed on Thymus species and Origanum vulgare.[4]

Subspecies[edit]

References[edit]

  1. ^ Sihvonen, P., 2005: Phylogeny and classification of the Scopulini moths (Lepidoptera: Geometridae, Sterrhinae). Zoological Journal of the Linnean Society 143: 473–530.
  2. ^ Fauna Europaea
  3. ^ LOT Moths and Butterflies
  4. ^ lepiforum.de


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!