Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coral-rich areas of outer reef slopes and drop-offs to depths greater than 40 m (Ref. 9710). Hides in caves or beneath ledges by day; forage for food at night, mainly on benthic crabs and shrimps. Spine of preopercle venomous.
  • Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Indonesia (including Mentawai Islands), Philippines, Solomon Islands, and Great Barrier Reef. Also reported from Malaysia (Ref. 5756), Tosa Bay, Japan (Ref. 559), and Viet Nam (Ref. 9706).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean and Western Pacific: Andaman Sea and Indonesia to Vanuatu, north to southern Japan, south to Western Australia, Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 13; Analspines: 4; Analsoft rays: 9
  • Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 173 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

27.0 cm TL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Stripes black to red above, with thin white interspaces. Black peduncular blotch and additional blotches at soft dorsal and anal fin bases that vary greatly in size between individuals or habitats. Large spine in anal fin blue (Ref. 48635). Alternating broad deep red and narrow silvery stripes on body. 1-6 spinules on posterior edge and 0-1 on anterior of nasal fossa. Preopercular spine 3/4 to nearly equal to orbit diameter. Four (4) oblique rows of scales on cheek. Body depth 2.7-3.0 in SL; head length 2.8-3.0 in SL; snout length 4.4-4.85 in head length; interorbital width 4.3-4.7 in head length; premaxillary groove extending slightly posterior to a vertical at anterior edge of orbit; anterior end of nasal bone ending in short spine that angles laterally; medial margin of nasal bone without spinule; 1-6 spinules at posterior edge of nasal fossa, 0-1 at anterior edge; upper edge of first suborbital bone with a laterally projecting spine near a vertical at the front edge of orbit, followed by a serrated ridge; preopercular spine varying from 3/4 to nearly equal to orbit diameter, 2.85-3.5 in head length; longest dorsal spines 3rd or 4th, 1.8-2.0 in head length; third anal spine 1.1-1.3 in head length (Ref. 27370).
  • Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Hides in caves or beneath ledges by day; forage for food at night, mainly on benthic crabs and shrimps. Spine of preopercle venomous.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 6 - 40 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 0.8 - 30
  Temperature range (°C): 28.343 - 29.325
  Nitrate (umol/L): 0.075 - 0.596
  Salinity (PPS): 32.200 - 34.393
  Oxygen (ml/l): 4.149 - 4.641
  Phosphate (umol/l): 0.071 - 0.380
  Silicate (umol/l): 1.097 - 6.058

Graphical representation

Depth range (m): 0.8 - 30

Temperature range (°C): 28.343 - 29.325

Nitrate (umol/L): 0.075 - 0.596

Salinity (PPS): 32.200 - 34.393

Oxygen (ml/l): 4.149 - 4.641

Phosphate (umol/l): 0.071 - 0.380

Silicate (umol/l): 1.097 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). Remain hidden in caves and crevices during daylight and emerge after sunset for nocturnal feeding. Feeds mainly on crustaceans (Ref. 54301).
  • Allen, G.R. 2004 Handy pocket guide to tropical coral reef fishes. Periplus Editions (HK) Ltd. 64 p. (Ref. 54301)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTCTATTTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTTATCCGAGCTGAACTTAGTCAACCCGGGGCTCTTCTGGGGGATGACCAAATTTATAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGTGGTTTCGGAAACTGACTAATTCCCCTAATAATTGGTGCCCCAGACATGGCATTTCCTCGAATGAACAACATGAGCTTCTGACTGCTCCCCCCTTCTTTCCTCCTTCTGCTTGCCTCTTCTGGGGTAGAAGCCGGAGCCGGGACAGGGTGAACAGTGTACCCGCCCCTGGCGGGTAACTTAGCCCACGCAGGGGCCTCCGTTGATTTGACCATCTTTTCCCTCCATTTAGCAGGCATTTCCTCAATCCTAGGGGCCATCAACTTCATTACAACAATTATTAATATGAAACCCCCGGCTATCTCTCAGTACCAGACACCTCTGTTCGTATGAGCTGTTTTAATTACAGCTGTTCTTCTCCTTCTCTCCCTGCCCGTCCTTGCCGCCGGCATCACCATGCTCCTAACGGACCGAAACCTAAACACCACCTTCTTTGACCCGTCAGGGGGTGGAGACCCAATTCTCTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sargocentron cornutum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATTTAGTATTTGGTGCCTGAGCTGGAATAGTTGGAACGGCCCTT---AGCCTTCTTATTCGAGCTGAACTTAGTCAACCCGGAGCCCTTCTGGGGGAC---GATCAAATTTATAATGTCATTGTTACAGCGCACGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATA---ATCGGAGCTCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTGCTACCTCCTTCATTCCTTCTTCTGCTAGCTTCTTCAGGAGTAGAAGCCGGTGCCGGAACAGGGTGAACAGTTTACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGATCTT---ACTATTTTCTCACTCCATTTAGCCGGTATTTCCTCAATCCTAGGGGCCATTAATTTTATTACAACTATCATTAATATGAAACCCCCTGCCATCTCCCAATATCAGACCCCTCTTTTCGTATGGGCTGTCCTAATTACAGCTGTCCTTCTTCTCCTGTCCCTACCTGTACTTGCAGCA---GGTATTACTATGCTGCTAACAGACCGAAATCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCTATCCTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron cornutum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!