Overview

Comprehensive Description

Biology

Inhabits surge-swept tunnels and crevices of the reef margin and reef front. Rarely occurs below 30 m, but has been observed at depths of 101 to 183 m in the Hawaiian Islands (Ref. 1602); majority of specimens collected in less than 3 m, often in tide pools (Ref. 27370). Benthopelagic (Ref. 58302). It disperses at night over sand flats and open reef bottom to feed on small crustaceans, crustacean larvae, and polychaete worms. Spine of preopercle venomous. Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and Algoa Bay, South Africa (Ref. 4201) to the Hawaiian and Easter islands, north to southern Japan and the Ogasawara Islands, south to northern Australia and the Austral Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Chagos, Comores, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands and Easter Island, north to southern Japan and Ogasawara Islands, south to Western Australia at 17°30'S, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body reddish silver, iridescent bluish above; scales finely dotted with black; spinous dorsal silvery white, with broad red margin (Ref. 4201). Five oblique scale rows on cheek; body depth 2.7-3.15 in SL; head length (HL) 2.75-3.1 in SL; snout length 4.0-4.65 in HL; interorbital width 3.6-4.05 in HL; small mouth terminal to slightly inferior, maxilla reaching from below front of iris to below center of eye, upper jaw length 2.7-3.15 in HL; premaxillary groove reaching to about a vertical at the front edge of orbit; anterior end of nasal bone rounded; medial margin of nasal bone without spinule; small nasal fossa without spinules on its edge; upper edge of suborbital bone below the eye weakly serrated, spineless laterally; short preopercular spine 1/2-3/4 orbit diameter, 4.75-6.45 in HL; 3rd-5th dorsal spine longest 2.0-2.3 in HL; 3rd anal spine 1.2-1.55 in HL (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits surge-swept tunnels and crevices of the reef margin and reef front. Rarely occurs below 30 m, but has been observed at depths of 101 to 183 m in the Hawaiian Islands (Ref. 1602). It disperses at night over sand flats and open reef bottom to feed on small crustaceans, crustacean larvae, and polychaete worms. Spine of preopercle venomous.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 183 m (Ref. 9710), usually 1 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 194 specimens in 1 taxon.
Water temperature and chemistry ranges based on 153 samples.

Environmental ranges
  Depth range (m): 0.305 - 100
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.019 - 1.204
  Salinity (PPS): 33.507 - 36.148
  Oxygen (ml/l): 4.444 - 5.079
  Phosphate (umol/l): 0.085 - 0.351
  Silicate (umol/l): 0.829 - 6.035

Graphical representation

Depth range (m): 0.305 - 100

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.019 - 1.204

Salinity (PPS): 33.507 - 36.148

Oxygen (ml/l): 4.444 - 5.079

Phosphate (umol/l): 0.085 - 0.351

Silicate (umol/l): 0.829 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 183m.
Recorded at 183 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in inshore waters. A nocturnal species (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron punctatissimum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGTCTTCTCATCCGAGCTGAACTGAGCCAACCCGGAGCTCTTCTGGGAGACGACCAGATTTACAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATAATCGGAGCCCCTGACATAGCATTCCCCCGAATGAATAATATAAGCTTCTGACTACTCCCCCCTTCATTCCTGCTTTTACTAGCCTCCTCAGGAGTAGAAGCTGGTGCCGGGACAGGATGAACGGTGTACCCACCCCTCGCAGGTAACTTAGCACACGCAGGGGCTTCTGTAGACCTAACTATTTTCTCACTTCATCTAGCAGGTATTTCCTCAATTCTAGGGGCCATTAACTTCATTACAACTATTATCAACATAAAACCTCCTGCTATTTCCCAATACCAAACACCTCTATTCGTGTGAGCTGTCCTTATTACAGCCGTCCTTCTTCTCCTATCTCTACCTGTCCTGGCAGCAGGAATTACCATGCTACTAACAGATCGTAATTTAAACACAACATTCTTCGATCCAGCAGGTGGTGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron punctatissimum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!