Overview
Comprehensive Description
Biology
Inhabits surge-swept tunnels and crevices of the reef margin and reef front. Rarely occurs below 30 m, but has been observed at depths of 101 to 183 m in the Hawaiian Islands (Ref. 1602); majority of specimens collected in less than 3 m, often in tide pools (Ref. 27370). Benthopelagic (Ref. 58302). It disperses at night over sand flats and open reef bottom to feed on small crustaceans, crustacean larvae, and polychaete worms. Spine of preopercle venomous. Minimum depth reported taken from Ref. 30874.
-
Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
http://www.fishbase.org/references/FBRefSummary.php?id=27370&speccode=12991
Trusted
Distribution
Indo-Pacific: Red Sea and Algoa Bay, South Africa (Ref. 4201) to the Hawaiian and Easter islands, north to southern Japan and the Ogasawara Islands, south to northern Australia and the Austral Islands.
-
Fricke, R. 1999 Fishes of the Mascarene Islands (Réunion, Mauritius, Rodriguez): an annotated checklist, with descriptions of new species. Koeltz Scientific Books, Koenigstein, Theses Zoologicae, Vol. 31:759 p. (Ref. 33390)
http://www.fishbase.org/references/FBRefSummary.php?id=33390&speccode=10
Trusted
Cargados Carajos, Chagos, Comores, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Letourneur, Y., M. Harmelin-Vivien & R. Galzin (1993). Impact of hurricane Firinga on fish community structure on fringing reefs of Reunion Island, S.W. Indian Ocean. Environmental Biology of Fishes 37: 109-120
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6048
Trusted
Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands and Easter Island, north to southern Japan and Ogasawara Islands, south to Western Australia at 17°30'S, New Caledonia and Rapa.
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Analspines: 4; Analsoft rays: 8 - 9
-
Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
http://www.fishbase.org/references/FBRefSummary.php?id=27370&speccode=12991
Trusted
Size
Max. size
23.0 cm TL (male/unsexed; (Ref. 30874))
-
Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
http://www.fishbase.org/references/FBRefSummary.php?id=30874&speccode=10294
Trusted
Diagnostic Description
Body reddish silver, iridescent bluish above; scales finely dotted with black; spinous dorsal silvery white, with broad red margin (Ref. 4201). Five oblique scale rows on cheek; body depth 2.7-3.15 in SL; head length (HL) 2.75-3.1 in SL; snout length 4.0-4.65 in HL; interorbital width 3.6-4.05 in HL; small mouth terminal to slightly inferior, maxilla reaching from below front of iris to below center of eye, upper jaw length 2.7-3.15 in HL; premaxillary groove reaching to about a vertical at the front edge of orbit; anterior end of nasal bone rounded; medial margin of nasal bone without spinule; small nasal fossa without spinules on its edge; upper edge of suborbital bone below the eye weakly serrated, spineless laterally; short preopercular spine 1/2-3/4 orbit diameter, 4.75-6.45 in HL; 3rd-5th dorsal spine longest 2.0-2.3 in HL; 3rd anal spine 1.2-1.55 in HL (Ref. 27370).
-
Randall, J.E. 1998 Revision of the Indo-Pacific squirrelfishes (Beryciformes: Holocentridae: Holocentrinae) of the genus Sargocentron, with descriptions of four new species. Indo-Pac. Fish. (27):105 p. (Ref. 27370)
http://www.fishbase.org/references/FBRefSummary.php?id=27370&speccode=12991
Trusted
Description
Inhabits surge-swept tunnels and crevices of the reef margin and reef front. Rarely occurs below 30 m, but has been observed at depths of 101 to 183 m in the Hawaiian Islands (Ref. 1602). It disperses at night over sand flats and open reef bottom to feed on small crustaceans, crustacean larvae, and polychaete worms. Spine of preopercle venomous.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 0 - 183 m (Ref. 9710), usually 1 - 30 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Depth range based on 194 specimens in 1 taxon.
Water temperature and chemistry ranges based on 153 samples.
Environmental ranges
Depth range (m): 0.305 - 100
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.444 - 5.079
Phosphate (umol/l): 0.085 - 0.351
Silicate (umol/l): 0.829 - 6.035
Graphical representation
Depth range (m): 0.305 - 100
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.444 - 5.079
Phosphate (umol/l): 0.085 - 0.351
Silicate (umol/l): 0.829 - 6.035
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 153 samples.
Environmental ranges
Depth range (m): 0.305 - 100
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.444 - 5.079
Phosphate (umol/l): 0.085 - 0.351
Silicate (umol/l): 0.829 - 6.035
Graphical representation
Depth range (m): 0.305 - 100
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 1.204
Salinity (PPS): 33.507 - 36.148
Oxygen (ml/l): 4.444 - 5.079
Phosphate (umol/l): 0.085 - 0.351
Silicate (umol/l): 0.829 - 6.035
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 183m.
Recorded at 183 meters.
Habitat: reef-associated.
Recorded at 183 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Found in inshore waters. A nocturnal species (Ref. 75154).
-
Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p. (Ref. 3921)
http://www.fishbase.org/references/FBRefSummary.php?id=3921&speccode=6021
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sargocentron punctatissimum
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGTCTTCTCATCCGAGCTGAACTGAGCCAACCCGGAGCTCTTCTGGGAGACGACCAGATTTACAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATAATCGGAGCCCCTGACATAGCATTCCCCCGAATGAATAATATAAGCTTCTGACTACTCCCCCCTTCATTCCTGCTTTTACTAGCCTCCTCAGGAGTAGAAGCTGGTGCCGGGACAGGATGAACGGTGTACCCACCCCTCGCAGGTAACTTAGCACACGCAGGGGCTTCTGTAGACCTAACTATTTTCTCACTTCATCTAGCAGGTATTTCCTCAATTCTAGGGGCCATTAACTTCATTACAACTATTATCAACATAAAACCTCCTGCTATTTCCCAATACCAAACACCTCTATTCGTGTGAGCTGTCCTTATTACAGCCGTCCTTCTTCTCCTATCTCTACCTGTCCTGGCAGCAGGAATTACCATGCTACTAACAGATCGTAATTTAAACACAACATTCTTCGATCCAGCAGGTGGTGGAGACCCAATTCTTTACCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sargocentron punctatissimum
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 23
Species With Barcodes: 1
Public Records: 11
Specimens with Barcodes: 23
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
-
Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
http://www.fishbase.org/references/FBRefSummary.php?id=30573&speccode=17471
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


