Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Pollacks are predator fish; they eat crustaceans and fish. They like to swim in the vicinity of ship wrecks, drilling platforms and rocky coasts. Pollacks have a good sense of hearing. When scuba divers are busy on the bottom, pollacks are often attracted by the noise. Young pollack are regularly found in eel traps located in the harbor of IJmuiden. They probably float in as eggs and larvae and migrate north later on.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found in inshore waters but also down to 200 m depth, in areas with hard bottoms. Juveniles are pelagic, spending 2-3 years near the coast including rocky areas, kelp beds, sandy shores and estuaries (Ref. 1371, 58137, 89343, 89362). Juveniles may form schools with saithe (Pollachius virens) (Ref. 88187), and have also been found solitary and defending its feeding territory (Refs. 42174, 89363). Larger individuals move to the open sea and are often found around rocky areas at 40-100 m depth (Ref. 1371). Also observed around shipwrecks and oil platforms (Ref. 88187). Occurs singly or in small dispersed shoals but is known to form dense shoals on spawning grounds (Ref. 89364). Suggested to undertake spawning migrations (Ref. 88171). Caught as bycatch in cod and saithe fisheries. Flesh is dry but of good flavor (Ref. 35388). Classified as a “hearing generalist” (89365); has also been found to produce sound. Juveniles have been reported to make repeated short grunts during competitive feeding and aggressive encounters (89366).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 Pollachius pollachius is a large fish up to 130 cm in length and weighing up to 14 kg. It has a relatively large mouth with a protruding lower jaw, no barbell and conspicuously large yellow eyes. Like other members of the cod family, this species has three dorsal fins; The first being triangular and the latter two longer. It has two anal fins. The tail is broad and slightly forked. The lateral line is dark green, strongly arched over the pectoral fin and straightens out just under the second dorsal fin. The pectoral fins are short, being as long as they are wide at the base. The colour of this species varies with habitat and age but it is usually dark brown or brownish-green on the back, abruptly paling to its yellow sides and paler undersides. All the fins are dark with the exception of the pelvic fins which may be slightly pink. The anus is just below the front half of the first dorsal fin.This is both a solitary and shoaling species, more likely to shoal during spawning events. Spawning in Pollachius pollachius occurs up to ca 100 meters depth between January and April, with the greatest intensity during March (Wheeler, 1969). The eggs and larvae drift in the water column towards the shallower coastal waters. Within the first year, juveniles can reach up to 17 cm in length. Juveniles live amongst rocks and algae mainly feeding on crustaceans in the shallows and then venture out to 40-100 m when about three years old with a body length of up to 40 cm (Wheeler, 1969). Young juveniles may also be found in estuaries. 

Large, older individuals of Pollachius pollachius are usually darker in colour, where juveniles are green, brown or occasionally crimson and gold. Such colouration ensures the juveniles are inconspicuous, although they may be easily confused with juveniles of Pollachius virens (Saithe) and other cod species. Adults of Pollachius virens have a straight lateral line and equal length jaws. Other similar species that may be confused for Pollachius pollachius are: Merlangius merlangus (whiting) that has an upper jaw longer than the lower, and Melanogrammus aeglefinus, that has a black pectoral spot and a black lateral line (Gibson et al., 2001).  

Pollachius pollachius feeds on deep sea prawns, Clupea harengus, Ammodytes tobianus, Sprattus sprattus, Mallotus villosus and other open water fish, and can be observed hanging above or within kelp forests and wrecks. This species hunts singly or in small groups by lying close to the sea bed watching sand eels shoaling above them. They suddenly dart up and grab their prey then resume their former position to let the shoal re-group. Such behaviour has been observed in juveniles hunting on groups of mysid shrimps or Gobius flavesecens (Naylor, 2003).

 

Pollachius pollachius has a small commercial fishery often caught with Gadus morhua in gill nets, traps or long lines. However, pollack is a popular species with anglers as they readily take bait (Wheeler, 1969).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The pollack has a typical cod family shaped body with three dorsal and two anal fins. The first anal fin starts underneath the first dorsal fin and is much longer than the second anal fin. The lower jaw protrudes the upper jaw and unlike many members of the cod family, it lacks a chin barbel. The sides and head are a silvery colour whilst the back is greenish-brown. There is a distinctive curve in the lateral line above the pectoral fin region. Adult fish can grow to 1.3m in length but most are approximately 50cm. The pollack is similar to the coalfish (Pollachius virens) however it can be distinguished by the shape of its jaw and lateral line.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northeast Atlantic: Iceland, the Faeroes and Norway to the Bay of Biscay (Ref. 1371); also southern Baltic Sea (Ref. 89342) with records from Poland, Latvia and Estonia (Refs. 36252, 52079).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baltic Sea, North Sea, Eastern North Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is common and widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 29 - 33; Analsoft rays: 27 - 30; Vertebrae: 52 - 55
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

130 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 18.1 kg (Ref. 40637); max. reported age: 8 years (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Lower jaw distinctly projecting beyond upper ones. Lacks a chin barbel. Dark lateral line that sharply curves over the pectoral fin and continues over whole body. No dark spot at pectoral fin base. Dorsal and anal fin interspaces short. Sensory canals with large pores on head. Body color is variable; dark dorsally, sharply distinguished from silver-gray sides and belly; the upper part of the body with yellow to orange streaks or blotches; the lateral line greenish. The fins uniformly dark except for the pelvic fins which are yellowish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); marine; depth range ? - 200 m (Ref. 6302), usually 40 - 100 m (Ref. 54707)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3244 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2317 samples.

Environmental ranges
  Depth range (m): -9 - 300
  Temperature range (°C): 6.466 - 12.270
  Nitrate (umol/L): 2.055 - 12.046
  Salinity (PPS): 31.839 - 35.570
  Oxygen (ml/l): 5.262 - 6.588
  Phosphate (umol/l): 0.310 - 0.827
  Silicate (umol/l): 1.843 - 10.823

Graphical representation

Depth range (m): -9 - 300

Temperature range (°C): 6.466 - 12.270

Nitrate (umol/L): 2.055 - 12.046

Salinity (PPS): 31.839 - 35.570

Oxygen (ml/l): 5.262 - 6.588

Phosphate (umol/l): 0.310 - 0.827

Silicate (umol/l): 1.843 - 10.823
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 This species can be found to >100 meters depth, either solitary or in small shoals. It is both an offshore pelagic or coastal benthic species found on the sea bed around rocks, wrecks and kelp forests.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shoals of pollack are often encountered in rocky areas or near wrecks, from the surface down to 200m depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Low- to mid-level predator. Juveniles feed mainly on crustaceans while adults prey mainly on fish but may also take cephalopods and pelagic crustaceans (Refs. 1371, 58137, 88187).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Pollachius pollachius (Pollock) is prey of:
Pollachius pollachius
Gadidae
Melanogrammus aeglefinus
Leucoraja erinacea
Leucoraja ocellata
Amblyraja radiata
Squalus acanthias
Lophius americanus
Cynoscion
Pomatomus saltatrix
Chondrichthyes
Homo sapiens

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Anisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pollachius pollachius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCTTGCTCATTCGAGCAGAGCTAAGTCAACCCGGCGCACTCCTTGGTGACGATCAAATTTATAATGTGATCGTTACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTGATAATTGGAGGTTTTGGAAACTGACTCATTCCTTTAATGATCGGTGCCCCAGATATGGCCTTTCCTCGAATAAATAACATGAGTTTCTGACTTCTCCCTCCCTCTTTCCTACTTCTTTTAGCATCATCAGGTGTAGAAGCCGGAGCAGGGACAGGGTGAACTGTTTATCCGCCTCTAGCCGGAAACCTCGCTCACGCAGGGGCTTCTGTTGATCTTACTATTTTCTCTCTTCACTTAGCAGGGATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAACATGAAACCTCCAGCAATTTCACAGTATCAAACACCCCTCTTTGTGTGAGCAGTACTGATTACAGCTGTGCTTCTATTACTGTCTCTCCCCGTCTTAGCAGCTGGTATCACAATACTTCTAACCGATCGTAACCTTAATACTTCCTTCTTTGACCCTGCAGGAGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pollachius pollachius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pollachius pollachius

Atlantic pollock, or European pollock, Pollachius pollachius, is a species of marine fish in the Pollachius genus. FAO uses English name pollack for this species. Together with Pollachius virens, it may also be referred to as pollock. Other names include European pollock, lieu jaune, and lythe. It is common in the north-eastern parts of the Northern Atlantic, including the Bay of Biscay and North Sea. Adults can grow up to 130 centimetres (51 in) and weigh up to 18.1 kilograms (40 lb), although more commonly their maximum length is 75 centimetres (30 in).[1][2]

Ecology and life history[edit]

Pollack are fast-growing and relatively short-lived.[2] The maximum reported age is 15 years.[3] They are said to spawn offshore, although their spawning grounds are poorly known; a study of a fjord population in Norway suggested local spawning.[4]

Pollack are benthopelagic, that is, they live near the sea floor.[2] They seem to be relatively sedentary.[4][5]

Fisheries[edit]

Pollack is of value to fisheries, although it mainly represents bycatch. Landings data show two fairly distinct centres of distribution, one in the northern North Sea/Skagerrak extending north along the Norwegian coast and one between the English Channel, the Irish Sea, and the northern part of the French west coast. Total reported landings are of order few thousands tonnes.[3]

Pollack is an important species in recreational fisheries. In Norway, tourist fishers alone were estimated to catch 100 tonnes of pollack in 2009.[6] In France, 3,500 tonnes of pollack was estimated to be caught in all recreational fisheries.[7]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2010). "Pollachius pollachius" in FishBase. October 2010 version.
  2. ^ a b c Cohen, Daniel M.; Tadashi Inada; Tomio lwamoto; Nadia Scialabba (1990). FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fisheries Synopsis. Rome: FAO. p. 442. 
  3. ^ a b ICES (2011). Report of the Working Group on the Assessment of Demersal Stocks in the North Sea and Skagerrak (WGNSSK), 4–10 May 2011, ICES Headquarters, Copenhagen. ICES Document. CM 2011/ACOM:13. Copenhagen: International Council for the Exploration of the Sea. p. 844. 
  4. ^ a b Heino, M.; Svasand, T.; Nordeide, J. T.; Ottera, H. (2012). "Seasonal dynamics of growth and mortality suggest contrasting population structure and ecology for cod, pollack, and saithe in a Norwegian fjord". ICES Journal of Marine Science 69 (4): 537. doi:10.1093/icesjms/fss043.  edit
  5. ^ Jakobsen, Tore (1985). Tagging of pollack on the Norwegian west coast in 1979. ICES Document. CM 1985/G: 24. Copenhagen: ICES. p. 3. 
  6. ^ Volstad, J. H.; Korsbrekke, K.; Nedreaas, K. H.; Nilsen, M.; Nilsson, G. N.; Pennington, M.; Subbey, S.; Wienerroither, R. (2011). "Probability-based surveying using self-sampling to estimate catch and effort in Norway's coastal tourist fishery". ICES Journal of Marine Science 68 (8): 1785. doi:10.1093/icesjms/fsr077.  edit
  7. ^ ICES (2010). Report of the Planning Group on Recreational Fisheries (PGRFS), 7-11 June 2010, Bergen, Norway. ICES Document. CM 2010/ACOM:34. Copenhagen: International Council for the Exploration of the Sea. p. 168. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!