Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Unusual among antennariids in often occupying brackish or even totally freshwater habitats. Most specimens were taken at 10 m depth or less. Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
  • Pietsch, T.W. and D.B. Grobecker 1987 Frogfishes of the world. Systematics, zoogeography, and behavioral ecology. Stanford University Press, Stanford, California. 420 p. (Ref. 6773)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Indonesia, New Guinea, the Solomons, the Philippines and Taiwan. Reported from Palau (Ref. 2847).
  • Pietsch, T.W. and D.B. Grobecker 1987 Frogfishes of the world. Systematics, zoogeography, and behavioral ecology. Stanford University Press, Stanford, California. 420 p. (Ref. 6773)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 12; Analsoft rays: 6 - 7
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm SL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Usually features one or two ocelli on the soft dorsal fin. Length to 14 cm (Ref. 48635).Description: Characterized by having variable colour, ranging from mottled tan or yellow to almost black; base of posterior dorsal fin rays with prominent pale-edged black spot; unbranched pelvic rays except posterior most bifurcate; illicium usually shorter than second dorsal spine; longitudinally folded appendage with numerous, slender filaments arising from base, esca; straight and free second dorsal spine; posteriorly curved third dorsal spine, 3.3-4.3 in SL; presence of caudal peduncle (Ref 90102).
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater; brackish; marine; depth range 0 - 10 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 10 - 10
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 73m.
Recorded at 73 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTTGTATTTGGAGCATGAGCCGGCATAGTAGGAACAGCACTTAGTCTACTAATCCGCGCAGAATTAAGCCAACCAGGCGCACTTTTAGGTGATGACCAAATCTATAATGTTATCGTTACAGCACATGCTTTTGTTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGCAATTGGTTGATTCCGCTAATAATCGGCGCCCCTGACATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTTTGCCTCCATCATTTCTCCTTTTACTAGCATCATCAGGAGTAGAAGCTGGGGCGGGCACAGGATGGACAGTTTACCCACCCCTTGCAGGTAACTTAGCCCATGCCGGGGCATCCGTTGATTTAACTATCTTCTCGCTACACCTCGCAGGTGTATCATCCATCCTAGGAGCTATTAATTTTATTACAACCATTATTAACATAAAACCCCCTGCTCTTTCACAATACCAAACACCTTTGTTTGTATGAGCAGTATTAGTCACTGCTGTACTACTCCTCCTTTCCCTCCCGGTTCTTGCTGCAGGCATTACAATATTATTAACTGACCGAAACCTTAACACAACCTTCTTTGACCCCACTGGAGGAGGGGACCCTATTCTATACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!