Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Unusual among antennariids in often occupying brackish or even totally freshwater habitats. Most specimens were taken at 10 m depth or less. Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Indonesia, New Guinea, the Solomons, the Philippines and Taiwan. Reported from Palau (Ref. 2847).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 120 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm SL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Usually features one or two ocelli on the soft dorsal fin. Length to 14 cm (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater; brackish; marine; depth range 0 - 73 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 10 - 10
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 73m.
Recorded at 73 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. Eggs are bound in ribbon-like sheath or mass of gelatinous mucus called 'egg raft' or 'veil' (Ref. 6773).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antennarius sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTTGTATTTGGAGCATGAGCCGGCATAGTAGGAACAGCACTTAGTCTACTAATCCGCGCAGAATTAAGCCAACCAGGCGCACTTTTAGGTGATGACCAAATCTATAATGTTATCGTTACAGCACATGCTTTTGTTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGCAATTGGTTGATTCCGCTAATAATCGGCGCCCCTGACATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTTTGCCTCCATCATTTCTCCTTTTACTAGCATCATCAGGAGTAGAAGCTGGGGCGGGCACAGGATGGACAGTTTACCCACCCCTTGCAGGTAACTTAGCCCATGCCGGGGCATCCGTTGATTTAACTATCTTCTCGCTACACCTCGCAGGTGTATCATCCATCCTAGGAGCTATTAATTTTATTACAACCATTATTAACATAAAACCCCCTGCTCTTTCACAATACCAAACACCTTTGTTTGTATGAGCAGTATTAGTCACTGCTGTACTACTCCTCCTTTCCCTCCCGGTTCTTGCTGCAGGCATTACAATATTATTAACTGACCGAAACCTTAACACAACCTTCTTTGACCCCACTGGAGGAGGGGACCCTATTCTATACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Antennarius sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!