Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhodometra sacraria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGATTATTTTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCATTAAGTCTATTAATTCGAGCAGAATTAGGAAATCCCGGTCAATTAATTGGAGAC---GACCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCAATTACTCTTTTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTATACCCTCCTTTATCTTCAAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCCGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATATGTCATTTGATCAACTACCATTATTCGTATGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTTCTTTCTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCCGGATTTGGTATAATTTCTCATATTATTTCTCAAGAAAGAGGTAAAAAGGAAACATTTGGATGTTTAGGAATAATTTATGCTATAATAGCAATTGGAATTCTTGGATTTATTGTTTGAGCTCATCATATGTTTACTGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhodometra sacraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rhodometra sacraria

The Vestal (Rhodometra sacraria) is a moth of the family Geometridae.

Description[edit]

Rhodometra sacraria has a wingspan reaching 22–28 mm, while the length of the forewings is 12–14 mm. These moths are easily distinguishable from the mahogany or pink stripe, located on yellowish or cream background, crossing diagonally the dorsal sides of the upperwings up to the apex. The dorsal sides of the hind wings are whitish. The intensity and the extent of the pink pigmentation is rather variable, depending on the seasonal temperature in the development of the pupae.

Usually the moths rest with a tent-like posture on twigs and herbs, with the wings parallel to each other. They fly from April to October in the northern hemisphere [1]. They are nocturnal and attracted to light.

Caterpillar of Rhodometra sacraria on a leaf of Rumex crispus

The caterpillars mimic twigs and therefore they are quite difficult to locate. They are slender and reach a length of about 25 millimeters. The basic colour is pale brown or green, with a whitish underside. The green forms usually show a dark brown or reddish irregular stripe on the back. The head is reddish brown and relatively small. These caterpillars feed on knotgrass, dock and other low growing plants.

Distribution[edit]

It is found throughout Europe, Africa and large parts of Asia.

Habitat[edit]

This species inhabits meadows, forest clearing, paths, gardens and urban environments.

Notes[edit]

  1. ^ The flight season refers to the Belgium and The Netherlands. This may vary in other parts of the range.

References[edit]

  • G. F. Hampson: The Fauna of British India. Moths. Vol. III. S. 424, Taylor and Francis, London 1895
  • Axel Hausmann: The Geometrid moths of Europe, 2. Sterrhinae. In A. Hausmann (Hrsg.): The Geometrid Moths of Europe 2. Apollo Books, Stenstrup 2004, ISBN 8-788-75737-4
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!