Molecular Biology and Genetics

Molecular Biology

Barcode data: Colostygia pectinataria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATCGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTGGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGTAATTGACTCGTACCTTTAATGCTTGGAGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTCTGATTATTACCTCCCTCTATTACCCTTTTAATTTCAAGTAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACTGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGAATTTCTTCTATTTTAGGCGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCCTTATTTGTCTGAGCTGTGGGAATCACAGCATTTTTACTTCTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACCTCATTTTTTGACCCCGCAGGAGGAGGAGATCCAATTCTCTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostygia pectinataria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostygia pectinataria

The Green Carpet, Colostygia pectinataria, is a moth of the genus Colostygia in the family Geometridae.

The moth has a wingspan from 22 to 28 mm. The strong forewing ground colour is green to bluish-green. The wing pattern shows the following colour sequence: a small region at the wing base brown green, the ensuing basal region brighter green, a wide and strongly serrated on the outside discal region dark green edged with white, the postdiscal region whitish green and the marginal region tinted brownish green. There are two distinct blackish spots near the front edge of the wing (costa) and one on the inner edge . In older specimens, the greenish colour can fade . Sometimes newly emerged hatched moths have a whitish, yellowish or pink colour. The hind wings shimmer grey white and have faint lines. The antennae of the males are combed, those of females are simple.

It is a Palearctic species found in the Iberian Peninsula over Western and Central Europe including the British Isles and East to the Altai Mountains.C. pectinataria reaches the Arctic circle in Fennoscandia, South the occurrence ranges from the Western Mediterranean to the Balkan peninsula, the Black Sea region and the Caucasus.

In the mountains C. pectinataria has been recorded at altitudes of over 2000 meters. Bogs, forests, bushy forest edges and damp heath areas are preferred.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!