Overview

Comprehensive Description

Squalius cephalus (Linnaeus, 1758)

Inland water: 28800-830 (1 spc.), 04.05.2001 , Sultanbahce Stream, Bahcekoey , Tekirdag , M. Ôzulug .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 36-36, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Most abundant in small rivers and large streams of barbel zone with riffles and pools. Found along shores of slow-flowing lowland rivers, even in very small mountain streams, and in large lake, undertaking spawning migration to inflowing streams. Adults are solitary while juveniles occur in groups. Feeding larvae and juveniles live in very shallow shoreline habitats. Feed on a wide variety of aquatic and terrestrial animals and plant material. Large individuals prey predominantly on fishes. Breed in fast-flowing water above gravel bottom, rarely among submerged vegetation. Often form fertile hybrids with Alburnus alburnus (Ref. 59043). Popular with amateur sport fishermen. Can be caught with various baits and lures. The flesh is of poor quality (Ref. 38587).
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

North, Baltic, northern Black, White, Barents and Caspian Sea basins, Atlantic basin southward to Adour drainage (France), Great Britain north to 56°N, Scandinavia: southern Finland, Sweden north to about Stockholm. Mediterranean basin from Var to Hérault (possibly Aude) (France) drainages. Introduced elsewhere. Naturally absent from Italy and Adriatic basin.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Very widespread in Qweik and Euphrates and Tigris drainages.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe and Asia Minor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eurasia: North, Baltic, northern Black, White, Barents and Caspian Sea basins, Atlatinc basins southward to Adour drainages (France), Great Britain north to 56°C, Scandinavia: southern Finland, Sweden north to abut Stockholm. Mediterranean basin from Var to Hérault (possibly Aude) (France) drainages. Introduced elsewhere, Naturally absent from Italy and Adriatic basin.
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in temperate and tropical seas and estuaries (including Mediterranean Sea, Black Sea, Red Sea, Seychelles, Madagascar, Mascarenes, Hawaiian Islands); introduced in some lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syria.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 7 - 9; Analspines: 3; Analsoft rays: 7 - 10; Vertebrae: 42 - 48
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 8,000 g (Ref. 2196); max. reported age: 22 years (Ref. 41616)
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from its congeners in France, North, Baltic, Arctic, Black and Caspian Sea basins by the possession of the following characters: dorsal profile with a well-marked discontinuity between head and trunk; a row of black pigments along free margin of each flank scale, forming a regular reticulate pattern, with no or very few pigments on central part of scales; anal and pelvic fins orange to red; dorsal fin with 8½ branched rays; anal fin with 8½ branched rays (rarely 9½); scales on lateral line 40-45 + 2-3; mouth terminal, with well marked chin; lower jaw tip not included in the upper lip; interorbital distance 37-42% HL; postorbital distance 47-51% HL; eye diameter 17-22% HL, 1.5-2.3 times in snout length; body depth 22-27% SL; lower jaw long, length greater than depth of operculum; iris whitish; pharyngeal teeth 2,5-5,2; in stretched anal fin of individuals larger than about 15 cm SL, distance between tips of first and last branched rays usually greater than caudal peduncle depth (Ref. 59043). Caudal fin with 19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Most abundant in small rivers and large streams of barbel zone with riffles and pools. Also along shores of slow-flowing lowland rivers, even in very small mountain streams. Also in large lakes, undertaking spawning migrations to inflowing streams. Spawns in fast-flowing water above gravel bottom, rarely among submerged vegetation.

Biology:
Juveniles are gregarious, adults more solitary. Lives up to 15 years, females longer than males. Males reproduce for the first time at 2-4 years, females at 4-6. Maturity is influenced by environmental factors and individuals may mature much later. Spawns in May-August, when temperature rises above 12°C. Females spawn more than once during a season. Individual females spawn with several males. Males assemble at spawning grounds and follow ripe females, often with much splashing, to shallow riffles. Females deposit the sticky eggs into the gravel. Feeding larvae and juveniles inhabit very shallow shoreline habitats. Feeds on a wide variety of aquatic and terrestrial animal and plant material. Large individuals become predominantly piscivorous. Frequently forms fertile hybrids with Alburnus alburnus.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Small to medium sized streams mostly in mountains and hilly areas.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; brackish; pH range: 6.0 - 7.8; dH range: 8 - 25; depth range 0 - ? m
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on plants, invertebrates and detritus (Ref. 6258).
  • Maitland, P.S. and R.N. Campbell 1992 Freshwater fishes of the British Isles. HarperCollins Publishers, London.368 p. (Ref. 6258)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning occurs in fast-flowing water above gravel bottom, rarely among submerged vegetation. Female spawn more than once during a season, individual females spawn with several males. Males assemble at spawning site and follow ripe females, often with much splashing, to shallow riffles. Females lays sticky eggs into the gravel (Ref. 59043). Pale yellow eggs are found attached to gravel, weed and stones in flowing water (Ref. 41678).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Leuciscus cephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Squalius cephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCCTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACTTTTAGGCGATGACCAAATTTATAATGTCATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGGGGATTCGGAAACTGACTTGTCCCGCTAATAATTGGTGCACCCGACATAGCATTCCCACGAATAAATAATATGAGCTTCTGACTTCTACCCCCATCATTCCTACTACTATTAGCCTCTTCTGGTGTTGAGGCTGGGGCCGGAACGGGGTGAACAGTATACCCACCGCTTGCGGGCAATCTTGCTCACGCAGGGGCATCAGTAGATTTAACAATCTTCTCACTCCATCTAGCAGGTGTATCATCAATTTTAGGGGCGGTCAACTTCATTACCACAATTATTAATATAAAACCCCCAGCCATCTCCCAATACCAAACACCTCTCTTTGTATGAGCCGTGCTGGTAACAGCCGTCCTTCTCCTCCTATCATTACCAGTTTTAGCTGCCGGAATTACGATGCTTCTTACAGATCGTAATCTTAATACCACATTCTTCGACCCGGCAGGGGGAGGAGACCCAATCCTATATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squalius cephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 76
Specimens with Barcodes: 91
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Freyhof, J.

Reviewer/s
Smith, K.

Contributor/s
Kottelat, M.

Justification
A widespread species with no known major widespread threats.

History
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Freyhof, J.

Reviewer/s
Ekmekçi, F., Esmaeili, H. & Smith, K.

Contributor/s

Justification
While the species is believed to have declined due to many threats in the area, it is still widespread occuring in many more then 10 independent populations and its decline is not thought to be great enough to qualify it for NT or any of the threat categories. It is therefore assessed as LC
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Believed to very slowly decline due to many threats in the area.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are many threats in the area but none is serious enough to really impact this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
There is no conservation action in place for this species and none seems to be needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Vostradovsky, J. 1973 Freshwater fishes. The Hamlyn Publishing Group Limited, London. 252 p. (Ref. 9696)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Squalius cephaloides

Squalius cephaloides is a species of cyprinid fish known only from the Armutlu Peninsula in Turkey.[1]

References [edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Squalius cephaloides" in FishBase. February 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

European chub

For European chubs other than this particular species, see Squalius.

The chub[1][2] (Squalius cephalus) is a European species of freshwater fish in the carp family Cyprinidae. It frequents both slow and moderate rivers, as well as canals and still waters of various kinds. In North America, this species is referred to as the European chub.[1] Other names used for the species include round chub, fat chub, chevin, and pollard.[citation needed]

Distribution[edit]

The species is distributed in most of the countries of Europe.[3]

Fishing for chub[edit]

European chub are popular with anglers due to their readiness to feed, and thus to be caught, in almost any conditions. Small chub are freely biting fish which even inexperienced anglers find easy to catch. As they become larger, however, chub become more wary and are easily spooked by noise or visual disturbance. Consequently, large chub (in excess of 2 kg) are keenly sought by anglers who prefer to target specific fish.

The British angling record for chub was broken in May 2007 when Steve White caught a 4.2-kg (9.2-lb) fish from a southern stillwater on a mainline boilie.[4] The chub can reach a maximum length of 60-80 cm (24-31.5 in).

Tackle[edit]

Small chub can be caught readily on light tackle: fly-fishing gear, a lure rod or a float rod, for example. Lines and hooks can be small, but baits are often of a relatively large size due to the chub's "greedy" nature. Larger chub, especially in floodwater conditions, must be fished with more substantial tackle: a stiff to moderately stiff rod, a strong line, strong hooks, and a large bait. Such enhanced equipment is needed due to the chub's predilection for taking cover in underwater snags. They frequently conceal themselves in deep holes or under the roots of trees, etc., and venture out to feed before returning quickly to cover.

Chub will readily take any natural bait. In addition to natural baits, however, they are renowned for their voracious appetites and will often be caught on baits as diverse as cheese, sweetcorn, bread, earthworms, and wasp larvae.

German chub catch from the typical environment

Tactics[edit]

As with many river fish, the best conditions for chub fishing are when the water is "carrying colour", when the clarity of the water has been temporary clouded by mud washing into the river, often following heavy rainfall. Under these conditions, a big, smelly bait is the best bet. Lob worms are a particular favourite, as is breadflake or paste. Another smelly favourite for chub are cheese flavours and a flavour called "scopex" which can be sprayed onto bait. When rivers are clear or swims are heavily fished, big baits are unlikely to work, so the best baits are single or double maggot close to, or under, the far bank features like overhanging trees. In certain waters, chub can become predators and can be caught on spinners or spoons.[5] Chubs have sharp, bone-crushing pharyngeal teeth at the back of their mouths, so care should be used when removing hooks.

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2012). "Leuciscus cephalus" in FishBase. 5 2012 version.
  2. ^ World Conservation Monitoring Centre 2010. Squalius cephalus. 2008 IUCN Red List of Threatened Species. Downloaded on 5 April 2010.
  3. ^ Squalius cephalus. 2008 IUCN Red List of Threatened Species. Downloaded on 5 April 2010.
  4. ^ "Chub Record Broken - FishingMagic Catch Reports". 
  5. ^ The Concise Encyclopedia of Fishing by Gareth Purnell, Alan Yates and Chris Dawn
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 3.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!