Articles on this page are available in 1 other language: Arabic (9) (learn more)

Overview

Distribution

Shadow darners are very common and are in all provinces and territories of Canada, as well as 42 states in the U.S. This species is not found in Utah, Arizona, Wyoming, Texas, Louisiana, Florida, Hawaii and Alaska.

There are two described sub-species: Aeshna umbrosa umbrosa, which is found in the eastern part of North America, and Aeshna umbrosa occidentalis, which is found in the western part of North America. They appear to differ only in geographic range.

Biogeographic Regions: nearctic (Native )

  • Brooks, S. 2003. Dragonflies. London: Smithsonian Books.
  • Dunkle, S. 2000. Dragonflies through binoculars: A field guide to dragonflies of North America. Oxford: Oxford University Press.
  • Johnson, J. 2011. "Sorting paddle-tailed and shadow darners out-of-hand" (On-line). Northwest Dragonflier. Accessed August 02, 2012 at http://nwdragonflier.blogspot.com/2011/10/sorting-paddle-tailed-and-shadow.html.
  • Manolis, T. 2003. Dragonflies and damselflies of California. Berkeley: University of California Press.
  • Montana Natural Heritage Program, 2011. "Shadow darner - Aeshna umbrosa" (On-line). Montana field guide. Accessed August 02, 2012 at http://fieldguide.mt.gov/detail_IIODO14190.aspx.
  • Needham, J., M. Westfall. 1955. A manual of the dragonflies of North America (Anisoptera): Including the Greater Antilles and the provinces of the Mexican Border. Berkeley: University of California Press.
  • Northern Prairie Wildlife Research Center, 2006. "Dragonflies and damselflies (Odonata) of the United States" (On-line). Accessed August 02, 2012 at http://www.npwrc.usgs.gov/resource/distr/insects/dfly/usa/149.htm.
  • Novelo-Gutierrez, R., K. Tennessen. 2010. Description of the larva of Aeshna persephone Donnelly, 1961 (Odonata: Aeshnidae). Zootaxa, 2484: 61-67.
  • Paulson, D. 2009. "Aeshna umbrosa" (On-line). The IUCN Red List of Threatened Species(TM). Accessed August 02, 2012 at http://www.iucnredlist.org/apps/redlist/details/165055/0.
  • Pelegrin, A. 2009. "Aeshna umbrosa Walker, 1908" (On-line). America Dragonfly. Accessed August 02, 2012 at http://america-dragonfly.net/globalResults.php?Species=2986&offset=10.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in Canada; eleven provinces and two territories, and the United States of America; forty-four states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Both males and females have pale gray-green faces with two antennae, a strong toothed jaw, and three large, bright eyes, or ocelli, which vary from blue-gray to brown and form a triangle. Surrounding these ocelli are the compound eyes, which are larger and darker in color. Unlike other species of dragonflies, shadow darners do not have a dark black stripe across the face. The head is approximately 7.4 to 8.4 mm long. The total length of a shadow darner is generally 6.5 to 7.8 cm. There are two pairs of large wings spanning approximately 8.5 to 10 cm. The forewings are slightly narrower than the hindwings, which are approximately 4.2 to 4.7 cm long.

The body is a powerful, brown thorax and a slender abdomen, with six spined legs and strong claws. In males, there are yellow-green stripes on the side of the thorax and blue stripes on the top. The abdomen has paired blue spots, usually on 9 out of its 10 segments. Females can have the same coloring as males, known as the blue form, or in rare cases, sometimes green spots (known as the green form), or a combination of green and blue spots, on the abdomen. Colors vary geographically in some cases: the Vancouver Island population has no abdominal spots, while populations living in colder climates generally have darker spots. Adults that have recently emerged from their larval shell will have pale, unpigmented bodies until the colors develop.

At the end of the abdomen, males have hooked anal appendages called cerci, while females' are unhooked. Females are also lacking the tuft of hair at the tip of the ovipositor sheath. Shadow darners are very similar to lance-tipped darners (Aeshna constricta), but can be differentiated by looking at the cerci. The cerci of shadow darners are much brighter. Often shadow darners are found flying around with paddle-tailed darners and are therefore often confused with this other species; however, paddle-tailed darners have the black stripe that shadow darners are lacking across their faces. Shadow darners also have paired spots on the ventral side of the abdomen, but paddle-tailed darners do not.

Range length: 6.5 to 7.8 cm.

Range wingspan: 8.5 to 10 cm.

Other Physical Features: ectothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Most commonly found in areas with standing water or slow-moving streams with shadowy areas, shadow darners usually inhabit lakes, ponds, boggy meadows, marshes, and mountain lakes in forests. They are also occasionally found in clearings or along roads, particularly when hunting. At higher elevations, this species has more diverse phenotypes.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: taiga ; forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A. umbrosa is found at lakes, ponds, even small ones, and slow streams. More common on streams than other Aeshna in its range. Colonizes small suburban ponds readily.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

By hawking for prey, shadow darners eat up to 20% of their body weight every day. They hunt primarily at dusk, as they are most active in the shade, but at any elevation and generally out in the open. Sometimes they hunt in a swarm with other shadow darners. They also use the spines on their legs to form a basket with which they can catch their prey. They usually eat any smaller insect, but especially mosquitoes, midges, and other dragonflies, as well as moths, locusts, and beetles. They do not, however, eat the wings of their prey, and so they pull these off before starting to eat. Naiads mostly eat larvae of aquatic insects, but sometimes supplement their diet with freshwater shrimp, tadpoles and small fish.

Animal Foods: amphibians; fish; insects; aquatic crustaceans

Primary Diet: carnivore (Insectivore )

  • Kraus, J. 2010. Diet shift of lentic dragonfly larvae in response to reduced terrestrial prey subsidies. Journal of the North American Benthological Society, 29/2: 602-613.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Shadow darners are predators and prey as both larvae and adults. During reproduction, shadow darner females lay their eggs inside the stems or leaves of plants to shield them from harsh weather. Many parasitic organisms, such as mites, parasitic worms and protozoans attach themselves to shadow darners during their emergence from the larval stage.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult shadow darners are extremely agile in the air, and so it's difficult for predators to catch them. However, birds such as American kestrels, Swainson's hawks, merlins, and purple martins specialize in catching dragonflies, and consequently have keen eyesight and can fly fast enough to catch them. Shadow darners are also, on occasion, eaten by large insects such as robber flies. Females can also be at risk during oviposition for predation by amphibians, like frogs and newts. Greenish-brown coloring of naids helps camouflage them from predators. However, when emerging from their larval skin, they are undefended, unable to fly, and vulnerable to predation by birds.

Known Predators:

Anti-predator Adaptations: cryptic

  • Platt, A., S. Harrison. 1995. Robber fly and trout predation on adult dragonflies (Anisoptera: Aeshnidae) and first records of Aeshna umbrosa from Wyoming. Entomological News, 106/5: 229-236.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Shadow darners rely heavily on seeing through their large, compound eyes which are designed to detect movement. They contain more ommatidia, or light-sensitive, photoreceptor cell clusters, than the eyes of any other insect. This allows them to see in color, and to detect ultraviolet and polarized light. They also have 3 ocelli located between the compound eyes, which are used to monitor the horizon and their orientation during flight. Shadow darners normally identify mates visually by recognizing colors, sizes, or shapes.

Since most of their prey are fast moving and easily visible, shadow darners do not need long antennae to reach out and search for prey. Males use their shortened antennae, legs and cerci to grasp a female that they are interested in mating. The male's cerci must successfully link to the back of the female's head, or the match won't work (perhaps because the organisms are of different species or of the same sex). A female who is disinterested in mating can reject a male by bending her abdomen down, thereby preventing the male's cerci from making a successful connection.

During the larval stage, shadow darners still rely on sight and touch. However, since most live in the water in boggy or swamp-like conditions, they rely more heavily on touch and therefore have longer antennae and smaller eyes.

Communication Channels: visual ; tactile

Perception Channels: visual ; ultraviolet; polarized light ; tactile ; chemical

  • Frye, M., R. Olberg. 1995. Visual receptive field properties of feature detecting neurons in the dragonfly. Journal of Comparative Physiology A: Neuroethology, Sensory, Neural and Behavioral Physiology, 177: 569-576.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

When the eggs are deposited at the end of the season in a cold climate, they enter diapause to survive the winter until they can hatch the following spring. Otherwise, the eggs generally hatch between 5 days and 2 months after oviposition, depending on the water temperature. The eggs hatch, releasing a very large, greenish-brown naiad, which is approximately 3.8 to 4.4 cm (1.5 to 1.75 inches) long. The naiad is wingless, faded in color, and lives in the water. When it is nearing the end of its larval life, the naiad climbs out of the water and switches from breathing through gills to breathing through spiracles in the thorax.

After a significant period of time in larval form, the naiad matures into the larger adult form, reaching up to 8.9 cm (3.5 inches) in length. At this time, it bursts its cuticle shell by swallowing water, and emerges from its naiad skin. During this process, the dragonfly is very vulnerable to predation, because it is soft and unable to fly until the new wings harden. For this reason, this process normally occurs at night. The adult dragonfly only lives for a few weeks.

Development - Life Cycle: metamorphosis ; diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In harsh environments, shadow darners experience diapause, which allows them to live for up to 7 months in the egg. In moderate climates, however, shadow darners generally hatch after about a week. After hatching, shadow darners begin their larval stage as naiads. The majority of their life (from approximately 2 months in warmer climates, up to several years in colder climates) is spent as a naiad. After leaving the larval stage, the shadow darner lives for approximately 2 weeks as an adult; however, this can be extended if the dragonfly survives more difficult environmental conditions in earlier stages (for example, a harsh Canadian winter). The longest known adult lifespan of any species of dragonfly is 77 days.

Range lifespan

Status: wild:
8 to 26 months.

Typical lifespan

Status: wild:
2 to 8 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Unlike some species of dragonflies, male shadow darners do not court females. Male and female shadow darners mate in flight using the tandem position, in which the male's head is at the female's tail and vice versa. The male transfers his sperm from the primary to the secondary genitalia, known as the hamulus, in preparation for copulation, and also removes any sperm inside the female from prior mates. The male then holds the female with his legs and cerci, while the female reaches underneath the male, forming the wheel position, and removes a sperm packet with which the eggs are fertilized. After mating, the male persuades the female to oviposit in his territory. During this process, the male guards the female to ensure that another male does not steal her before she finishes ovipositing.

Mating System: polygynandrous (promiscuous)

Adults become sexually mature approximately 2 to 3 weeks after leaving the larval stage, but this can take longer in more severe climates. Breeding occurs from late April through the end of November. Since their sexually active lifespan is so short, shadow darners mate as often as possible (generally every 1 to 5 days) for the duration of their adult lives. After the male and female mate, the female fertilizes the eggs and oviposits in the late afternoon and early evening, usually into aquatic plants or wet, decaying wood. She is able to cut a hole in the plant with a chitinous blade that is part of her ovipositor. The number of eggs in each clutch varies depending on the climate and amount of sunlight available, but is usually around 500.

Breeding interval: Shadow darners breed often as possible (every 1 to 5 days).

Breeding season: Shadow darners breed from late April to November.

Range age at sexual or reproductive maturity (female): 3 to 20 weeks.

Range age at sexual or reproductive maturity (male): 3 to 20 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

The male chooses a territory that is a prime site for oviposition to ensure successful hatching of eggs. He then guards the site from other males, thereby protecting any eggs that may have been deposited there. The female protects the eggs inside her until it is time for oviposition. To deposit them safely, she uses her chitinous blade to cut holes in plants, making a nest-like arrangement to protect the eggs until they hatch.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aeshna umbrosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 60 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTTTACTTTTTATTCGGAGCATGATCAGGAATAGTAGGAACTNCTCTAAGAGTTTTAATTCAAATTGAATTAGGACAACCAGGATCATTAATTGGAGATGATAAAATTTATAGTGTAATTGTAACAGCACACGCTTTTGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGTAAATTGGTTAGTACCACTAATATTAGGGGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGNTTTTGATTATTACCTCCCTCATTAACANTACTATTAGCAGGAAGTATGGTTGAAAGAGGAGCTGGAACAGCTTGAACTGTATATCCTCCTCTGGCTGGTGCAATTGCCCATGCAGGAGCATCAGTAGATTTAACTATTTTTTCTTTACATTTAGCCGGAGTATCTTCAATTCTAGGAGCTATTAATTTTATTACAACAACAATTAATATAAAATCACCAGGAATAAAGATAGATCAAATACCTTTATTTGTATGAGCTGTTGTAATTACAGCTGTACTTTTATTACTCTCTTTACCAGTTTTAGCTGGTGCAATTACTATTCTATTAACAGATCGAAATATTAATACNTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aeshna umbrosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 55
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Shadow darners are not threatened or endangered. They are classified as a species of "least concern" by the IUCN Red List of Threatened Species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Paulson, D. R.

Reviewer/s
Clausnitzer, V. & Kalkman, V. (Odonata Red List Authority)

Contributor/s

Justification
A. umbrosa is common all across North America and there is no indication of any population decline nor are any threats currently identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A. umbrosa is an abundant and widespread species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no threats presently affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in many federal, state, local, and private reserves and does not appear to need any further conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Many humans incorrectly believe that shadow darners are venomous, and are therefore scared of them. However, all dragonflies can sometimes carry parasites, and when eaten raw could potentially transmit these parasites to a human. Dragonflies are rarely eaten in North America, and so this is an unusual occurrence in the case of shadow darners.

Negative Impacts: injures humans (causes disease in humans )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shadow darners, like other dragonflies, play a critical role in pest control, particularly in crops and water storage, where much damage is caused by mosquitoes. For example, mosquito larvae often inhabit rice fields or water containers, where they pose particular threat to both the crop and to humans, as they carry numerous fatal diseases. By adding a few shadow darner larvae, the mosquitoes can be controlled, and even eliminated entirely. Shadow darners also eat other pests and disease vectors, including locusts, moths, sandflies and wood-boring beetles.

Researchers have also noted that a reduction in the population of shadow darners is often a sign of water contamination, and can therefore be used as a warning sign for conservationists.

Positive Impacts: source of medicine or drug ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Shadow Darner

The shadow darner (Aeshna umbrosa) is a species dragonfly in the family Aeshnidae. It is found in almost all of Canada and most states in the United States.

Identification[edit]

The shadow darner is a large dragonfly with a length of 68 to 78 mm (2.7 to 3.1 in). The base is brownish black in color. Greenish crescent-shaped spots are found at the top of the thorax. The sides of the thorax are marked with two yellowish to yellowish-green diagonal stripes. Its abdomen is marked with bluish green spots. The male shadow darner has paddle-shaped anal appendages.

The naiad of the shadow darner is large in size, with a length of 38 to 43 mm (1.5 to 1.7 in). This naiad is long and slender, which is the typical shape of immature darners. Its mottled green and brown. The shadow darner has a vertically flattened cerci with a spike at the end, which is much brighter than the lance-tipped darner.

Distribution[edit]

This dragonfly is found in most of the United States except the dry Southwest and all of the provinces and territories of Canada except Newfoundland.

Habitat and diet[edit]

The shadow darner patrols along small marshy streams. Its often found feeding along woodland edges or even in deep shadow in full forest. Shadow darners can also be found near ditches, slow streams, and ponds. This darner has a long flight season of late April to November.

The shadow darner naiad feeds on a wide variety of aquatic insects, such as mosquito larvae, other aquatic fly larvae, mayfly larvae, and freshwater shrimp. They also feed on small fish and tadpoles. This sdult will eat almost any soft-bodied flying insect, including mosquitoes, flies, butterflies, moths, mayflies, and stoneflies.

Ecology[edit]

The naiad is an active predator and are able to swim by jet propulsion. They squirt water out from the ends of their abdomens. They will generally take several years to mature, and when the immature changes into a dragonfly, it does so at night. This behavior probably was evolved to avoid being eaten be daytime predators. The adult generally flies from late April to November, and does all of its hunting while on the wing. The shadow darner is able to regulate its body temperature which enables it to fly in temperatures too cold for most dragonflies. This dragonfly species in particular seems to be extremely cold tolerant. This dragonfly flies at dusk and in shaded areas, and it flies later into the fall than any species other than the yellow-legged meadowhawk (Sympetrum vicinum).

Reproduction[edit]

Male shadow darners establish and defend territories along the shores of slow streams and ponds. After both genders mate, females fly singly, without the male attached, to lay their eggs in the stems and leaves of aquatic plants.

Subspecies[edit]

  • A. u. occidentalis
  • A. u. umbrosa

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!