Articles on this page are available in 1 other language: Arabic (9) (learn more)

Overview

Distribution

Range Description

This species occurs in Canada; eleven provinces and two territories, and the United States of America; forty-four states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A. umbrosa is found at lakes, ponds, even small ones, and slow streams. More common on streams than other Aeshna in its range. Colonizes small suburban ponds readily.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Aeshna umbrosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 55
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Aeshna umbrosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 60 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACACTTTACTTTTTATTCGGAGCATGATCAGGAATAGTAGGAACTNCTCTAAGAGTTTTAATTCAAATTGAATTAGGACAACCAGGATCATTAATTGGAGATGATAAAATTTATAGTGTAATTGTAACAGCACACGCTTTTGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGTAAATTGGTTAGTACCACTAATATTAGGGGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGNTTTTGATTATTACCTCCCTCATTAACANTACTATTAGCAGGAAGTATGGTTGAAAGAGGAGCTGGAACAGCTTGAACTGTATATCCTCCTCTGGCTGGTGCAATTGCCCATGCAGGAGCATCAGTAGATTTAACTATTTTTTCTTTACATTTAGCCGGAGTATCTTCAATTCTAGGAGCTATTAATTTTATTACAACAACAATTAATATAAAATCACCAGGAATAAAGATAGATCAAATACCTTTATTTGTATGAGCTGTTGTAATTACAGCTGTACTTTTATTACTCTCTTTACCAGTTTTAGCTGGTGCAATTACTATTCTATTAACAGATCGAAATATTAATACNTCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Paulson, D. R.

Reviewer/s
Clausnitzer, V. & Kalkman, V. (Odonata Red List Authority)

Contributor/s

Justification
A. umbrosa is common all across North America and there is no indication of any population decline nor are any threats currently identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A. umbrosa is an abundant and widespread species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no threats presently affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in many federal, state, local, and private reserves and does not appear to need any further conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Shadow Darner

The shadow darner (Aeshna umbrosa) is a species dragonfly in the family Aeshnidae. It is found in almost all of Canada and most states in the United States.

Identification[edit]

The shadow darner is a large dragonfly with a length of 68 to 78 mm (2.7 to 3.1 in). The base is brownish black in color. Greenish crescent-shaped spots are found at the top of the thorax. The sides of the thorax are marked with two yellowish to yellowish-green diagonal stripes. Its abdomen is marked with bluish green spots. The male shadow darner has paddle-shaped anal appendages.

The naiad of the shadow darner is large in size, with a length of 38 to 43 mm (1.5 to 1.7 in). This naiad is long and slender, which is the typical shape of immature darners. Its mottled green and brown. The shadow darner has a vertically flattened cerci with a spike at the end, which is much brighter than the lance-tipped darner.

Distribution[edit]

This dragonfly is found in most of the United States except the dry Southwest and all of the provinces and territories of Canada except Newfoundland.

Habitat and diet[edit]

The shadow darner patrols along small marshy streams. Its often found feeding along woodland edges or even in deep shadow in full forest. Shadow darners can also be found near ditches, slow streams, and ponds. This darner has a long flight season of late April to November.

The shadow darner naiad feeds on a wide variety of aquatic insects, such as mosquito larvae, other aquatic fly larvae, mayfly larvae, and freshwater shrimp. They also feed on small fish and tadpoles. This sdult will eat almost any soft-bodied flying insect, including mosquitoes, flies, butterflies, moths, mayflies, and stoneflies.

Ecology[edit]

The naiad is an active predator and are able to swim by jet propulsion. They squirt water out from the ends of their abdomens. They will generally take several years to mature, and when the immature changes into a dragonfly, it does so at night. This behavior probably was evolved to avoid being eaten be daytime predators. The adult generally flies from late April to November, and does all of its hunting while on the wing. The shadow darner is able to regulate its body temperature which enables it to fly in temperatures too cold for most dragonflies. This dragonfly species in particular seems to be extremely cold tolerant. This dragonfly flies at dusk and in shaded areas, and it flies later into the fall than any species other than the yellow-legged meadowhawk (Sympetrum vicinum).

Reproduction[edit]

Male shadow darners establish and defend territories along the shores of slow streams and ponds. After both genders mate, females fly singly, without the male attached, to lay their eggs in the stems and leaves of aquatic plants.



Subspecies[edit]

  • A. u. occidentalis
  • A. u. umbrosa

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!