Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) North Dakota, South Dakota, Nebraska, Kansas, Oklahoma, South Dakota, Texas, Saskatchewan, and Alberta form the western range limits (Guenther and McCafferty, 2005; 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species was recently reported from several sites in New Hampshire (Chandler et al., 2006). This species was recently documented for the first time in Colorado in Yuma Co. (Myers and Younghanz, 2007). In South Dakota, it occurs in Brown, Codington, Custer, Hutchingson, Pennington, and Union Cos. (Geunther and McCafferty, 2008). In South Carolina, it occurs in Abbeville, Aiken, Allendale, Anderson, Bamberg, Barnwell, Cherokee, Chester, Chesterfield, Claredon, Colleton, Edgefield, Fairfield, Florence, Greenville, Greenwood, Jasper, Kershaw, Lancaster, Laurens, Lexington, McCormick, Newberry, Oconee, Orangeburg, Pickens, Richland, Saluda, Spartanburg, Union, Williamsburg, and York Cos. (McCafferty and Meyer, 2008). McCafferty et al. (1997) cited occurrences in Oklahoma from Delaware, Cherokee and Mayes Cos. in Spring Creek. Whiting (1992) cites occurrences in Nova Scotia in Antigonish and Shelbourne Cos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stenacron interpunctatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 75 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCTTTACTTCATCTTTGGAGCCTGATCGGGAATAGTAGGGACATCTTTGAGACTACTTATTCGTGCTGAATTAGGACAGCCCGGTTCCTTGATTGGGGATGATCAAATCTACAATGTAATTGTAACAGCCCATGCTTTTATTATGATTTTCTTCATGGTTATGCCTATTATGATTGGGGGATTTGGTAATTGACTAGTACCCCTAATGTTAGGAGCTCCTGATATGGCTTTCCCCCGAATAAACAATATGAGATTCTGACTACTCCCTCCTGCCCTAACACTACTTCTGGCTAGAAGTATAGTTGAAAGAGGTGCTGGCACTGGTTGGACGGTTTACCCTCCCCTATCGGCAGGAATTGCTCATGCTGGAGCTTCCGTAGATCTCGCTATTTTCTCACTTCATCTCGCAGGGGTCTCTTCTATTCTAGGGGCAGTAAACTTTATCACTACTACCATCAACATACGATCCACAGGAATAACAATGGACCGGATCCCCTTATTTGTTTGATCAGTACTGATTACGGCCATTCTCCTTTTATTGTCTCTCCCAGTATTAGCAGGAGCTATTACAATACTCCTAACAGATCGGAACTTAAATACCTCTTTCTTTGATCCCGCTGGTGGGGGAGATCCCATTTTGTACCAGCACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stenacron interpunctatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 102
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: North Dakota, South Dakota, Nebraska, Kansas, Oklahoma, South Dakota, Texas, Saskatchewan, and Alberta form the western range limits (Guenther and McCafferty, 2005; 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!