Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Ceranthia lichtwardtiana is endoparasitoid of larva of Acasis viretata

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Acasis viretata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Acasis viretata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGGACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGGTCTTTAATTGGGGATGATCAAATTTATAACACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCCTTAATATTGGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCAATCACCCTGCTAATTTCGAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCGCCTTTGTCCTCTAATATTGCCCATGGAGGAAGATCTGTAGATCTAGCTATTTTTTCCCTACATTTAGCAGGAATTTCTTCAATCCTGGGAGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCGGTAGGAATCACAGCTTTCCTTCTCTTATTATCTTTACCTGTATTAGCTGGGGCAATCACAATACTATTAACAGACCGTAATCTTAATACTTCATTTTTTGACCCTGCAGGAGGGGGAGACCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acasis viretata

The Yellow-barred Brindle (Acasis viretata) is a moth of the Geometridae family. It is found from most of Europe to eastern Asia. It is also present in North America.

The wingspan is 25–29 mm. The base colour of the forewing is olive-green, but soon fades to yellowish. There is a black and green band running across the forewing. The hindwing is white. Adults are on wing from mid April to October in two generations in western Europe.

The larvae feed on a wide variety of plants, including Rhamnus frangula, Hedera helix, Ligustrum, Ilex aquifolium, Cornus sanguinea and Sorbus aucuparia.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!