Overview

Brief Summary

Melipona beecheii is one of several hundred bee species--almost all tropical meliponines--that produce abundant honey. This bee’s natural range extends from Mexico to Costa Rica. Originally a resident of tropical lowland forests, it was adapted to the variety and cycles of the forest resources, e.g., a major flowering period and honey storage phase during the dry season followed by a dearth of nectar and pollen during the wettest part of the year or during prolonged drought. Over the centuries, however, there has beeen extensive deforestation over much of its range and this bee now forages largely in second-growth habitats.

Because of its ease of management (the large forager size, long flight range, and numerous virgin queens for colony propagation are especially beneficial characteristics of Melipona for beekeepers) and excellent honey production, M. beecheii has been the preferred species for use by humans in its range. This species was apparently the only bee propagated using traditional husbandry techniques anywhere in the tropics. Rearing of M. beecheii was a culturally and economically important practice by the Mayans of the Yucatán peninsula long before the arrival of the Spanish in the New World and today beekeepers rearing these bees still keep them mainly in traditional log hives. Lopez-Maldonado (2005) explored the cultural significance of M. beecheii in the Mayan civilization. 

Recent data indicate a radical decline in colonies kept by beekeepers and apparently in the wild as well. This bee appears to be threatened by both environmental changes and by inappropriate management and conservation efforts. These bees are very sensitive to pesticides (Valdovinos-Núñez et al. 2009). Overharvest and failure to transfer colonies to hives or divide them are apparently significant sources of problems for beekeepers keeping M. beecheii. Melipona beecheii is apparently rare in the wild, even in forested areas. It nests only in hollows within trees of ≥ 30 cm girth. Furthermore, the traditional practice of propagating domesticated colonies is not being taken up by younger generations of Maya.

There is substantial justification for serious concern about the status of M. beecheii. However, there is some hope that meliponiculture is poised for expansion in the New World and elsewhere, as suggested by these articles in the New York Times (Main 2012) and American Scientist (Youngsteadt 2012) and by recent efforts to improve and share methods for rearing meliponine bees (e.g., González-Acereto et al. 2006; Kwapong et al. 2010).

(Villanueva-Gutierrez 2005 and references therein)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

General Ecology

Overview

Description:

            M. beecheii has a life cycle like that of other honey bees.  Individuals start out as eggs that hatch into larvae, and eventually pupate into adults.  The adult is a stingless honey bee that looks like a typical honey bee you can see anywhere.  It has six legs and four wings – two large and two small on either side.  It has two antennae on its head below two large compound eyes.  The thorax is completed covered in hair, and the hair extends onto the abdomen, head, and legs.  As the name suggests, these bees lack a sting on their abdomen, differentiating them from many other species of bee.

Predators and parasites:

The typical predators of this bee are all kinds of birds, spiders, lizards, and other bugs (Besmeijer and Toth, 1998) The biggest pest species to M. beecheii is the parasitic phorid fly, Pseudohypocera kerteszi.  Besides this, there don’t seem to be many parasites or disease causing organisms to honey bees.  American foulbrood, caused by Paenibacillus larvae, is a fairly important disease among all kinds of honeybees, though there isn’t really any data on its effect on M. beecheii specifically. (Hart et al., 2009).

Mutualisms:

Bees are often dependent on mutualisms with flowering plants.  They pollinate the flowers by moving pollen and nectar from plant to plant, in the process collecting food for themselves or their colony.  There is not any data on the exact species of flowering plants that M. beecheii form these mutualisms with, but they’re patterns and habits have been studied and so we know they do indeed have this relationship (Biesmeijer and Toth, 1998).
            The main competitors for a pollinating insect like M. beecheii are other pollinating insects.  This includes other stingless bees, such as Melipona fasciata, and intraspecific competition with other hives of the same species.  There are no other direct studies of competition, but other scholarly papers shed some light on what are probably serious competitors for M. beecheii.  Melendez-Ramirez et al. (2004) described the pollinating habits of other bees, flies, and beetles in the Yucatan area, where M. beecheii is native.

Abiotic factors:

            Smaller animals tend to show less resistance to abiotic fluctuations than larger ones.  Insects tend to be very vulnerable to changes in temperature, precipitation, sunlight, or any other possible abiotic factors.  M. beecheii has been observed in both humid and dry tropical rainforests.  Studies that take temperature into account have found that typical temperatures where M. beecheii range from 16°C to 41°C, and annual rainfall was between 2000 and 3000 mm (Beismeijer and Toth, 1998).

            Corbet et. al (1993) described the environmental factors of Melipona bicolor bicolor, and also noted its similarity to M. beecheii.  They observed that temperature was the most important abiotic factor influencing the behavior of bees, and that the best operating temperature range for the bees in their study was from 16°C to 26°.  This falls within the range described by Beismeijer and Toth (1998).  Oliveira (1973) noted a trend in M. bicolor bicolor in regards to sunlight.  Activity decreased as days went from sunny to cloudy.  Another study by Hilario et al. (2000) showed that the same species had its highest flight activity from 60-89% humidity, and the most was seen at the highest humidity.  While these studies do not all apply directly to M. beecheii, they are both stingless bees that live in South American tropical forests.  More Direct studies of M. beecheii would be needed to be sure of the abiotic factors that are best for them, but the data from M. beecheii can be useful for predicting what they would be.

  • 1.) Biesmeijer JC et al. 1999. Nectar foraging by stingless bees in Costa Rica: botanical and climatological influences on sugar concentration of nectar collected by Melipona. Apidologie. 30: 43-45.
  • 2.) Beismeijer J C and Toth E. 1998. Individual foraging, activity level and longevity in the stingless bee Melipona beecheii in Costa Rica (Hymenoptera, Apidae, Meliponinae). Insectes soc. 45: 427–443.
  • 3.) Colli-Ucan W, Roubik D W, and Villanueva R. 2005. Extinction of Melipona beecheii and traditional beekeeping in the Yucatán peninsula. Bee World. 86(2):35-41.
  • 4.) Corbet S A, Fussell M, Ake R, Fraser A, Gunson C, Savage A, and Smith, K. 1993. Temperature and pollination activity of social bees. Ecological Entomology. 18(1): 17-30.
  • 5.) Hart A G, Medina L M, and Ratnieks F L W. 2009. Hygienic behavior in the stingless bees Melipona beecheii and Scaptotrigona pectoralis (Hymenoptera: Meliponini). Genetics and Molecular Research. 8(2): 571-576.
  • 6.) Hilario S D, Imperatriz-Fonseca V L, and Kleinert A de M P. Flight activity and colony strength in the stingless bee Melipona bicolor bicolor (Apidae, Meliponinae). 2000. Rev. Bras. Biol. 60(2): 299-306.
  • 7.) Melendez-Ramirez V et al. 2004. Mixed mating strategies and pollination by insects and wind in coconut palm (Cocos nucifera L. (Arecaceae)): importance in production and selection. Agricultural and Forest Entomology. 6: 155-163.
  • 8.) Oliveira M A C, 1973, Algumas observações sobre a atividade externa de Plebeia saiqui e Plebeia droryana. MSc Dissertation. Dep. Zoologia, Instituto de Biociências, USP, São Paulo. 79.
  • 9.) Wenseleers T et al. 2004. Queen execution and caste conflict in the stingless bee Melipona beecheii. Etholgy. 110: 725-736.
Creative Commons Attribution 3.0 (CC BY 3.0)

© fvaron1

Supplier: fvaron1

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melipona beecheii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTTTAATTGGAGGTTTCGGAATTTTTTTAATTCCATTAATA---TTAGGATCACCAGATATAGCATTTCCACGAATAAATAATATTAGATTTTGATTACTACCTCCTTCATTAATATTATTATTATTAAGAAATATATATTTCCCAAGTTCAGGAACAGGATGAACAATTTATCCTCCACTATCATCCTATATATATCATTCTTCTCCATCTGTTGATTTT---ACAATTTTTTCTATTCATATAACTGGAATTTCATCTATTTTAGGATCTTTAAATTTTATTGTAACTATTTTTATAATAAAAAATTTTTCACTAAATTATGATCAAATTAATTTATTTTCATGATCAATTTCTATTACTGTAATTTTATTAATTTTATCCTTACCTGTTTTAGCTGGA---GCAATTACAATATTATTATTTGATCGAAATTTAAATACATCATTTTTTGATCCTATAGGAGGAGGAGATCCAATTCTATATCAACACTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGACTAATTTCTCAAATTATTATAAATGAAAGAGGAAAAAAA---GAAATTTTTGGAAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGATTTATCGTATGAGCACATCATATATTTACTGTAGGATTAGATATTGATACACGTGCATATTTTACATCAGCAACAATAATTATTGCAATTCCTACAGGAATTAAAGTTTTTAGTTGATTA---GCTACATATCATGGATCA---AAATTAAATTTTAATATTTCATTTATATGATCAATTGGATTTATTTTAATATTTACAATTGGAGGATTAACTGGAATTATATTATCAAATTCATCAATTGATATTATTTTACATGATAGATATTACGTAGTAGGTCATTTTCATTATGTA---TTATCTATAGGAGCAGTATTTTCTATTATTGCTAGATTTATTCACTGATTTCCATTAATTTCTGGACTTTTAATAAATCAAAAATGATTAAAATCTCAATTTTTTTTTATATTTATTGGAGTAAATTTAACATTTTTTCCTCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melipona beecheii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!