Molecular Biology and Genetics

Molecular Biology

Barcode data: Apis nigrocincta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTAATTGGAGGTTTTGGAAATTGATTAATTCCATTAATA---TTAGGATCTCCTGATATAGCATTTCCTCGAATAAATAATATTAGATTCTGATTACTACCTCCATCATTATTTTTATTATTACTAAGAAATTTATTTTATCCAAGACCAGGAACAGGATGAACAGTATACCCCCCCCTATCTGCATACCTATACCATTCTTCACCTTCAGTAGATTTT---GCAGTATTTTCACTTCATATATCTGGAATCTCATCAATTATAGGATCATTAAATTTAATGGTTACAATTATAATAATAAAAAATTTTTCATTAAATTATGATCAAATTTCTTTATTTCCATGATCAGTATTTATTACAGCTATCCTATTAATTATATCTCTTCCAGTATTAGCTGGA---GCAATTACAATATTACTTTTTGATCGAAATTTTAATACTTCATTTTTTGATCCTATAGGAGGTGGAGACCCTATTTTATACCAACACTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGATTAATCTCACATATTGTAATAAACGAAAGAGGTAAAAAA---GAAATTTTTGGAAATTTAGGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGTTTTATTGTTTGAGCACATCATATATTTACTGTAGGTTTAGATGTTGACACACGAGCATATTTTACTTCAGCAACAATAATTATTGCCGTTCCTACAGGAATTAAAGTATTTAGATGATTA---GCAACATATCATGGTTCA---AAATTAAAATTAAATATTTCAGTTTTATGATCTTTAGGATTTATTTTATTATTTACAATTGGAGGATTAACAGGAATTATACTTTCAAATTCATCAATTGATATTATTTTACATGATACATATTATGTAGTTGGTCATTTTCATTATGTA---TTATCAATAGGTGCCGTATTTGCAATTATTTCAAGATTTATCCATTGATATCCATTAATTACAGGATTACTACTTAATGTTAAATGATTAAAAATTCAATTTATTATAATATTTATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apis nigrocincta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Apis nigrocincta

Apis nigrocincta is a species of honey bee that inhabits the Philippine island of Mindanao as well as the Indonesian islands of Sangihe and the Celebes or Sulawesi.

The species builds nests in cavities like the closely related Apis cerana. In fact, there are few substantial differences between the two species: the genitals of the respective drones, for instance, are identical. However, there are small morphological differences, genetic polymorphism in the mitochondrial DNA, as well as behavioral differences.

In areas where the A. cerana and A. nigrocincta live together, they can most immediately be distinguished by their coloration and size: A. cerana tends to be darker and smaller, while A. nigrocincta tends to be larger and have a yellowish clypeus (the lower area of the face). They can best (reliably) be differentiated using morphometrics, which can also be used to identify morphologically distinct populations in both species.

The architecture of the colonies is also a point of difference: the opening of the drone cell of A. cerana is covered in wax, under which there is a conical cocoon with a central hole or pore. In A. nigrocincta, however, the cell of the drone has a narrow opening, without a hard wax cap and hole. In addition, the queens of A. nigrocincta generally create colonies with greater numbers of drones than those of A. cerana.

Another noticeable behavioral difference between the species is the time of day at which they prefer to gather pollen.

A. nigrocincta contracts the parasite-caused honey bee disease Varroatosis by playing host to the species of Varroa mite known as Varroa underwoodi. In this way, they are similar to Apis cerana nuluensis, which is also susceptible to the same species of parasite.

References

  • Hadisoesilo, S.; Otis, G. W.; Meixner, M. (1995). "Two distinct populations of cavity-nesting honey bees (Hymenoptera: Apidae) in South Sulawesi, Indonesia". Journal of the Kansas Entomology Society 68 (4): 399–407. JSTOR 25085613.
  • Smith, D. R.; Hagen, R. H. (1996). "The biogeography of Apis cerana as revealed by mitochondrial DNA sequence data". Journal of the Kansas Entomology Society 69 (4): 294–310. JSTOR 25085726.
  • Damus, M.; Otis, G. (1997). "A morphometric analysis of Apis cerana F. and Apis nigrocincta Smith populations from Southeast Asia". Apidologie 28 (5): 309–323. doi:10.1051/apido:19970507.
  • Smith, D. R.; Villafuerte, L.; Otis, G.; Palmer, M. R. (2000). "Biogeography of Apis cerana F. and A. nigrocincta Smith: insights from mtDNA studies". Apidologie 31 (2): 265–280. doi:10.1051/apido:2000121.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!