Molecular Biology and Genetics

Molecular Biology

Barcode data: Apis cerana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 42 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATAAAATGATTTATATCAACAAATCATAAAAATATTGGAATTTTATATATTTTATTAGCTTTATGATCAGGAATATTAGGCTCATCAATAAGGTTGATTGTTCGCATAGAATTAAGATCCCCCGGTTCATGAATTAATAATGATCAAATTTATAATACAGTTGTAACAAGACATGCATTCCTAATAATTTTTTTTATAGTTATACCATTCCTAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATAGCATTTCCTCGAATAAATAATATTAGATTCTGATTACTTCCTCCTTCATTATTTATATTATTATTAAGAAATTTATTTTATCCAAGACCAGGAACAGGATGAACAGTTTATCCTCCATTATCTGCATATTTATATCATTCATCCCCTTCAGTTGATTTTGCAATTTTCTCCTTACATATATCTGGAATCTCATCAATTATAGGATCATTAAATTTAATAGTTACAATTATAATAATAAAAAATTTTTCATTAAATTATGACCAAATTTCTTTATTTCCATGATCAGTATTTATTACAGCAATCTTATTAATTATATCTCTTCCAGTTCTAGCTGGAGCAATTACAATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCAATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGCCACCCAGAAGTTTATATTTTAATTCTTCCAGGATTTGGACTAATTTCTCATATTGTTATAAATGAAAGAGGAAAAAAAGAAATTTTTGGAAACCTAGGTATAATTTACGCAATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTAGGATTAGATGTTGATACACGAGCTTATTTTACTTCAGCAACAATAATTATTGCTGTTCCTACAGGAATTAAAGTATTTAGATGATTAGCAACATATCATGGTTCAAAATTAAAATTAAATATTTCAGTTTTATGATCTTTAGGTTTTATTATATTATTTACAATTGGAGGATTAACAGGAATTATACTTTCAAATTCATCAATTGACATTATTCTTCATGATACATACTATGTAGTTGGTCATTTTCATTATGTATTATCAATAGGAGCAGTATTTGCAATTATTTCAAGATTTATTCATTGATATCCATTAATTACAGGTTTACTTCTTAATGTTAAATGACTAAAAATTCAATTCATTATAATATTTATTGGTGTAAATTTAACATTTTTCCCTCAACATTTTTTAGGATTAATATCTATACCTCGACGATACTCAGATTATCCAGATTCATATTATTGTTGAAATTCAATTTCATCTTTAGGATCAATAATTTCATTAAATAGAATTATCTTTCTAATTTTTATTATTCTTGAAAGATTAATTTCTAAACGAATAATATTATTTAAATTTAATCAATCATCACTTGAATGATTAAATTTTTATCCTCCATTAGATCATTCACATTTAGAAATTCCATTATTAATTAAAAACTTAAACATAAAATCAATTTTAATTAAATTTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apis cerana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 42
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Apis cerana


Apis cerana, or the Asiatic honey bee (or the Eastern honey bee), is a species of honey bee found in southern and southeastern Asia, such as China, India, Korea, Japan, Malaysia, Nepal, Bangladesh and Papua New Guinea. This species is the sister species of Apis koschevnikovi, and both are in the same subgenus as the Western (European) honey bee, Apis mellifera.[1][2][3][4]

Contents

Subspecies [edit]

(following Engel, 1999).

Eight subspecies of A. cerana are currently recognized. Out of these, two subspecies are predominant and used for apiculture in India: Apis cerana cerana and Apis cerana indica. These species are similar to Apis mellifera except in color. A. cerana indica have black stripes on their abdomen and they live close to hilly areas and are sometimes seen in plains regions. A. cerana cerana have yellow stripes on their abdomen and are habituated to plains regions of India. A. mellifera tends to be slightly larger than A. cerana, which can be readily distinguished from A. mellifera. These are less aggressive and also display less swarming behavior than any other wild bees such as Apis dorsata and Apis florea and therefore can be easily used for beekeeping.[citation needed]

Behavior [edit]

In the wild, A. cerana prefer to nest in small spaces, such as hollowed out tree trunks. They have a foraging range of about 1 km. Most of their biology is similar to A. mellifera with slight differences in dance language, comb cell size and honey production. They are similar in size or somewhat smaller than Apis mellifera and have smaller comb cells as well. They also have more prominent abdominal stripes. Their honey yield is smaller, because they form smaller colonies. In folk medicine, their beeswax is used to treat and heal wounds. Like the Western honey bee, they are sometimes domesticated and used in apiculture, mostly in wooden boxes with fixed frames. These bees can be adapted to living in cavities in some human structures and in purpose-made hives, and their nesting habit means that they can potentially colonize temperate or mountain areas with prolonged winters or cold temperatures.[citation needed]


Absconding behavior [edit]

Apart from reproductive swarming, A. cerana have migration and absconding behavior, abandoning the current nest and building a new nest in a new location where there is an abundant supply of nectar and pollen available. These bees usually don’t store great amounts of honey. This means that they are more vulnerable to starvation if there is a prolonged shortage of nectar and pollen. Absconding will start when there is not enough pollen and nectar. After the last brood emerges, the adult bees fill their honey stomachs from the hive's stores and swarm to establish a new nest at a new location. A. cerana has more absconding behavior than A. mellifera.

Nest defense [edit]

A. cerana are more inclined to retreat inside than to attack an intruder passing near their nest. But any attempt to open the nest, especially if it is done roughly, will cause bees to fly out and sting the intruder.

Nest thermoregulation [edit]

A. cerana maintains internal hive temperatures with a precision similar to that of A. mellifera, using similar mechanisms. A. cerana colonies maintain their blood temperature in the range of 33–35.5 °C even while ambient temperatures vary between 12 and 36 °C. This mechanism clearly shows that they possess effective nest thermoregulation systems. During summer A. cerana employs evaporative cooling, where the worker bees cluster outside the nest in hot weather and fan their wings, thus removing excess heat and moisture from the nest and decreasing the hive temperature.

  • Thermal defense: When an Apis cerana hive is invaded by the Japanese giant hornet (Vespa mandarinia), about 500 Japanese honey bees (A. cerana japonica) surround the hornet and vibrate their flight muscles until the temperature is raised to 47 °C (117 °F), heating the hornet to death, but keeping the temperature still under their own lethal limit (48–50 °C). European honey bees (A. mellifera) lack this behavior. [5]

Communication [edit]

A. cerana communicate with their nest members about the presence and location of food and water sources by means of waggle dance and round dance languages. The waggle and round dances of A. cerana are performed in the dark on a vertical comb surface of a multicomb nest, so their wagging motions are conveyed via vibrations. Their dancing cycles are very slightly shorter than A. mellifera.

Reproductive swarming [edit]

In A. cerana, reproductive swarming is similar to A. mellifera. A. cerana reproductive swarms settle 20–30 meters away from the natal nest (the mother or primary colony) and stay for a few days before departing for a new nest site after getting information from scout bees. Scout bees search for suitable cavities in which to construct the swarm’s home. Successful scouts come back and report the location of suitable nesting sites to the other bees by performing communication dances on the surface of the swarm cluster in the same way they would do for food sources.

Worker sterility and queen signaling [edit]

Honeybee workers are infertile females and possibility of their reproduction is extremely limited. Their fertility is controlled by queen signals. The queen honeybee informs workers of her presence by pheromones that she secretes from her mandibular glands. These signals are acquired by workers in close vicinity of the queen and then spread to other workers in the colony, mainly by body contacts. In presence of queen pheromone signals, the vast majority of workers refrain from activating their ovaries. In the absence of a queen bee, at least 5%[citation needed] of the worker bees activate their ovaries and start laying eggs, which can lead to multiple eggs in one cell. When this occurs, other workers will attempt to remove the eggs, a phenomenon known as worker policing.

Apis cerana from Nepal

Pests [edit]

Apis cerana is the natural host to the mite Varroa jacobsoni and the parasite Nosema ceranae, both serious pests of the Western honey bee.[6] Having coevolved with these parasites, A. cerana exhibits more careful grooming than A. mellifera, and thus has an effective defense mechanism against Varroa that keeps the mite from devastating colonies. Other than defensive behaviors such as these, much of their behavior and biology (at least in the wild) is very similar to that of A. mellifera.

Apis cerana from India

Genetic Database [edit]

The Biomodeling Laboratory at Seoul National University has constructed an Asian honey bee transcriptome database using a next generation sequencing technique (Illumina hiseq2000 and GS-FLX 454 technology). This database interface will support researchers to get the molecular and sequence information about Apis cerana more easily.view

References [edit]

  1. ^ BIODIVERSITY OF HONEYBEES, M.R.Srinivasan, Department of Agricultural Entomology - Tamil Nadu Agricultural University accessed Jul 2010
  2. ^ Engel, M.S. (1999) The taxonomy of recent and fossil honey bees (Hymenoptera: Apidae: Apis). Journal of Hymenoptera Research 8: pp. 165–196.
  3. ^ Photos of Apis cerana
  4. ^ Benjamin P.Oldroyd and Siriwat Wongsiri: Asian Honey Bees (Biology, Conservation, and Human Interactions). 2006: Harvard University Press, Cambridge, Massachusetts and London, England.
  5. ^ Apis cerana' "cooking" a hornet to death video
  6. ^ Ritter, Wolfgang Nosema ceranae Albert Ludwigs University of Freiburg
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!