Overview

Brief Summary

The blue orchard bee (Osmia lignaria), also known as the orchard mason bee, mason bee, orchard bee, and Osmia bee, is named for its shiny blue coloration and the fact that it pollinates orchard crops. These bees are native to North America and are found throughout most of the United States. However, this bee is not established in the deep south and is rare in the Great Plains.

The blue orchard bee is slightly smaller than a honey bee; males are approximately 11 to 12 mm and females are approximately 14 mm in length. They are a shiny dark blue color. Males have longer antennae and an additional tuft of light colored hair on their faces than females. Females have hairs on the underside of their abdomens adapted for carrying pollen.

  • How to Manage the Blue Orchard Bee: As an Orchard Pollinator (J. Bosch and W. Kemp, Sustainable Agriculture Network, 2001)
  • Orchard Mason Bees (Gardening in Western Washington, Washington State University Extension)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Nesting Biology

Nest in holes in wood blocks or pithy stems. Also in crevices, mud or paper nests of wasps, ground nests of bees, and carpenter bees (Xylocopa). Cell partitions and caps are made of mud (Cane et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Gonzalez Betancourt, Victor Hugo

Source: Anthophila – an online repository of bee diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is wide ranging and includes most of temperate North America, including parts of probably all states except Alaska, Florida, and Hawaii. In the east, it ranges from Nova Scotia to Georgia and west to Michigan and Texas. In the west, it has been found from southern British Columbia to southern California and eastward to South Dakota and Texas. In mid-latitude regions, this species has been found in locally dense populations from sea level to 6,000 feet (1,800 m), but normally becomes scarce at altitudes greater than 7,000-8,000 feet (2,100-2,400 m) (Bosch and Kemp 2001). At least 31 counties in Colorado.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Comments: According to Sandhouse (1939), "in the original account of the species it is said to "nidificate in old wood." Packard records it as being found in cells under stones, while Rau has found it resealing old nests of the mud dauber Sceliphron caementarium and of other species of bees."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is found in wooded areas and forest edges, but also around homes in towns and cities. Females create nest sites in existing holes in wood.

  • How to Manage the Blue Orchard Bee: As an Orchard Pollinator (J. Bosch and W. Kemp, Sustainable Agriculture Network, 2001)
  • Orchard Mason Bees (Gardening in Western Washington, Washington State University Extension)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology of pollination- changes in recent decades

Seasonal temperature changes are an important factor in determining when plants come into bloom. If there are significant changes in annual temperature cycles over time, the blooming schedule can be altered worldwide. This begs an important question for plant pollination. Have the insects and other animals that service animal-pollinated plants altered their behavioral calendar in a similar way?

Using historical museum datasets and recent bee-monitoring data, North American researchers have examined this question in ten species of wild bees: Colletes inaequalis, Andrena crataegi, Andrena carlini, Andrena miserabilis, Osmia pumila, Osmia bucephala, Osmia atriventris, Osmia lignaria, Bombus impatiens, and Bombus bimaculatus. Over the past 130 years, there has been a significant shift toward emergence earlier in the Spring among these bees, which average approximately ten days earlier now than in the late 1800s. This trend was most pronounced in the last forty years.(Bartomeus et al, 2011)

Does this shift resemble a shift in the bloom schedule of the plants these bees visit? Changes in plant bloom times in response to climate change have been a subject of intensive study recently and data is available through several studies of native plants in North America, from herbarium records and monitoring programs (Miller-Rushing et al, 2006; Primack et al, 2004; Bradley et al, 1999; Cook et al, 2008). Among 106 native plants that are visited by these ten bee species, there is also a significant trend toward earlier flowering. This trend also became more pronounced in the last forty years.(Bartomeus et al, 2011)

Do these two shifts mean that bees will continue to be active during appropriate periods to take advantage of the bloom calendar? That is difficult to say. Emergence and bloom dates are quite variable, and all ten of these bee species visit many different species of plant, which have different bloom calendars. Another important research question: do schedule shifts also correspond for specialist plant-pollinator pairs, where a single species of animal visits a single species of plant?

  • Ignasi Bartomeusa, John S. Ascherb, David Wagnerc, Bryan N. Danforthd, Sheila Collae, Sarah Kornbluthb, and Rachael Winfreea. 2011. Climate-associated phenological advances in bee pollinators and bee-pollinated plants. Proceedings of the National Academy of Science, 108(51): 20645-20649
  • Miller-Rushing AJ, Primack RB, Primack D, Mukunda S. 2006. Photographs and herbarium specimens as tools to document phenological changes in response to global warming. Am J Bot 93:1667–1674.
  • Primack D, Imbres C, Primack RB, Miller-Rushing AJ, Del Tredici P. 2004. Herbarium specimens demonstrate earlier flowering times in response to warming in Boston. Am J Bot 91:1260–1264.
  • Bradley NL, Leopold AC, Ross J, Huffaker W. 1999. Phenological changes reflect climate change in Wisconsin. Proc Natl Acad Sci USA 96:9701–9704.
  • Cook BI, Cook ER, Huth PC, Thompson JE, Smiley D. 2008. A cross-taxa phenological dataset from Mohonk Lake, NY and its relationship to climate. Int J Climatol 1383: 1369–1383.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The blue orchard bee is a solitary nester, but it is gregarious so prefers to nest in groups. Males emerge in the spring and females emerge several days later, living for about a month. Females mate soon after emerging and begin nesting within three to four days, creating nests in existing holes in wood. The female places a mud plug at the bottom of the nest and then she brings pollen and nectar into the nest. An egg is laid and the cell is sealed with a thin mud plug. The female continues building the nest in this way and then seals it with a thick mud plug. Larvae hatch from the eggs after a few days. The larvae then spin cocoons and pupate within the cells. Pupae turn into adults at the end of the summer but remain in the cocoons throughout the winter.

  • How to Manage the Blue Orchard Bee: As an Orchard Pollinator (J. Bosch and W. Kemp, Sustainable Agriculture Network, 2001)
  • Orchard Mason Bees (Gardening in Western Washington, Washington State University Extension)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia lignaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCGTTATGATCTGGAATAATTGGTTCAGCTATAAGAATTATTATTCGAATAGAATTAAGTATTCCTGGATCATGAATTTCTAATGACCAAATCTATAATTCTTTAGTTACAGCTCATGCTTTTTTAATAATTTTTTTTCTTGTAATACCATTTTTAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCTTTTCCCCGAATAAATAATATTAGATTTTGACTTTTACCCCCATCTTTAATAATTTTACTTTTAAGAAATTTTTTAAATCCAAGACCAGGAACAGGATGAACTGTATATCCTCCTTTATCTTCAAATTTATACCATTCTTCACCCTCAGTAGATTTAGCAATTTTTTCTTTACATATTTCAGGATTATCTTCTATTATAGGATCACTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCCTTAAAACATATACAATTACCTTTATTTCCTTGATCTGTTTTTATTACAACTATTCTTTTACTTTTTTCCTTACCAGTATTAGCTGGTGCTATTACTATATTATTATTTGACCGAAATTTTAATACATCTTTTTTTGATCCAACTGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Osmia lignaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: A basically common, economically important, mason bee. This is an inspection rank until the status is better evaluated and most likely it should be G5

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Other Considerations: Turns up in almost all recent inventories in the east, e.g. in Maine, Virginia, Mississippi, Michigan

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10-25%

Comments: Increasing due to agricultural use.

Global Long Term Trend: Increase of 10-25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: No information specifically for restoring rare species was found. There is a lot of information about augmenting mason bes as pollinators.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollinator

Blue orchard bees are good pollinators of early spring orchard crops and are used commercially. These bees pollinate crops such as apple (Malus domestica), cherry (Prunus spp.), raspberry (Rubus spp.), peach (Prunus persica), cranberry (Vaccinium spp.), strawberry (Fragaria spp.), radish (Raphanus sativus), and sage (Salvia spp.). They also pollinate wildflowers like waterleaf ( Hydrophyllum spp.) and fiddleneck (Amsinckia spp.).

Blue orchard bees are good commercial pollinators of orchard crops for several reasons. These bees are relatively easy to handle because they are non-aggressive. They are easy to manage and are self-sustaining with little maintenance; population size can increase by about 2 1/2 times per year. Blue orchard bees are also efficient pollinators because they land directly upon the reproductive structures of blossoms. A female blue orchard bee's abdomen is covered in hairs and these hairs pick up pollen. When the bee moves to the next flower to forage, it inadvertently transfers the pollen to the new blossom's reproductive structures. Also, blue orchard bees are highly active, even under poor weather conditions, and are fast flyers with a high bloom visitation rate. Finally, far fewer blue orchard bees than honey bees (Apis mellifera) are needed to provide pollination services - depending on the crop, about 250-300 nesting blue orchard bee females per acre are required whereas one strong hive, between 25,000 and 30,000, of honey bees per acre are required.

  • Blue orchard bees and fruit tree pollination, www.Osmia.com; Orchard Mason Bees, Gardening in Western Washington, Washington State University Extension
  • Orchard Mason Bees, Evan A. Sugden, July 1999, Washington State University Cooperative Extension, King County
  • How to Manage the Blue Orchard Bee: As an Orchard Pollinator, J. Bosch and W. Kemp, Sustainable Agriculture Network, 2001.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: In North America the usual management strategy is providing supplemental nesting sites generally in an agricultural context, or simply leaving natural nesting habitat intact.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Osmia lignaria

Osmia lignaria, commonly known as the orchard mason bee or blue orchard bee,[1] is a megachilid bee that makes nests in reeds and natural holes, creating individual cells for their brood that are separated by mud dividers. Unlike carpenter bees, they cannot drill holes in wood. O. lignaria is a common species used for early spring fruit bloom in Canada and the United States, though a number of other Osmia species are cultured for use in pollination.

Native origin[edit]

O. lignaria is among 4000 native bee species of North America, and its species is divided by the Rocky Mountains into two subspecies, O. l. propinqua and O. l. lignaria. For those who keep mason bees, USDA entomologists have strongly suggested O. l. lignaria is kept because of its native origin, as the bees are likely to have greater success in their original climate and in propagation[disambiguation needed] efforts.

Life cycle[edit]

Spring[edit]

The bees begin to emerge from their cocoons in the spring when the daytime temperature reaches 14 °C (57 °F).[2] The males emerge first. They remain near the nesting site and wait for the females to begin their emergence, which can be several days to weeks depending on the number of days of warm weather. The first thing the females do is mate. A female will typically mate once, maybe twice. She will be absent from the nesting site for several days while she feeds and waits for her ovaries to fully mature.

"Bee house" used for Osmia lignaria
Orchard mason bee on an apple bloom
Example of nesting site variations

When a female is ready, she seeks out a suitable nest. O. lignaria females nest in narrow holes or tubes, though they have been found to nest inside cedar shakes and even keyholes. Beekeepers place prepared nesting materials to entice the females to stay close to the orchard or nearby forage. Good nesting material (reeds, paper tubes, wood trays or "bee condos") are as important as having the proper mud available (silty/clayey, as well as correct moisture content to grab/pack the mud). A female might inspect several potential nests before settling in. Once she has found a preferred nesting cavity, she flies outside of the hole and does an in-flight dance. She is orienting on major visual features to find her nest when she returns from foraging.

Orchard mason bees arrange their nests as a series of partitions, with one egg per partition. A female begins the process by collecting mud and building the back wall, if necessary, of the first partition. She then makes several back-and-forth trips to nearby flowers. Unlike honey bees, which visit flowers that are miles away, females visit flowers that are nearest the nest. One bee can visit 75 flowers per trip, and it takes 25 trips to create a complete pollen/nectar provision. The female works tirelessly during the day, only stopping once the sun has gone down. When the sun rises the next morning, she basks in its rays until warm enough to fly, then continues foraging.

Once the pollen provision is large enough, she backs into the hole and lays an egg directly upon it. She then collects more mud to seal off the partition. The new wall also doubles as the back wall of the next cell, and she continues until she has filled the nest hole with a series of offspring. O. lignara bees, like many insects, can select the gender of the egg they lay by fertilizing the egg, or not. Unfertilized eggs are males, while fertilized eggs are females. The adult bee lays female eggs in the back of the burrow, and the male eggs towards the front. On average, she lays about three males and one to two females per cavity. Because females are larger than males and require more pollen reserves, cavity dimensions can play a significant role in the cavity selection process.

When the egg hatches, the larva consumes the food provision and goes through many changes before becoming an adult. It will spend most of its life alone in this dark cell made by its mother.

Once the female has finished the nest, she plugs the entrance with a mud wall, thicker than the partitions that precede it. She then seeks another location for a new nest. She works tirelessly until she dies. An O. lignaria female lives for about four to eight weeks, and can fill an average of four six-inch tubes in her lifetime, with about eight eggs per tube. Her work includes nearly 60,000 blossom visits, and has attracted growers to propagate the insect for pollination purposes in fruit orchards.

Summer[edit]

By early summer, a larva has consumed all of its provisions and begins spinning a cocoon around itself and enters the pupal stage; the adult, flying mother dies off as the season progresses.

Fall and winter[edit]

The young bee is now a fully developed insect and undergoes diapause inside its cocoon for the duration of the winter. To stay warm, they burn through their fat reserves. If the weather stays cold for too long, the bees can die of starvation. Alternatively, if the temperature rises too fast, emergence may occur prematurely when pollen is scarce or the weather can return to cold temperatures for too long. Farmers are known to exploit the emergence cycle and time their release to coincide with the first orchard blossoms.

Defense[edit]

Orchard mason bees, like all mason bees, are very shy and will only sting if they perceive serious danger. They will not attack to defend themselves. The stinger is actually an egg guide. Because of their docile behavior, mason bees are preferred by people who desire pollination in urban settings.

See also[edit]

Further reading[edit]

  • Bosch, Jordi; Kemp, William P. (2001). How to Manage the Blue Orchard Bee. Sustainable Agriculture Network. ISBN 978-1888626063. 
  • Griffin, Brian (1999). The Orchard Mason Bee (2nd ed.). Knox Cellars Publishing. ISBN 978-0963584120. 
  • Krombein, Karl V. (1967). Trap-nesting Wasps and Bees: Life Histories, Nests, and Associates. Smithsonian Institution Press. ISBN 978-0874740332. 

References[edit]

  1. ^ Black, Scott Hoffman; Shepherd, Matthew; Vaughan, Mace; LaBar, Caitlin; Hodges, Nathan (November 2009), Yolo Natural Heritage Program (HCP/NCCP): Pollinator Conservation Strategy, Portland, OR / Sacramento, CA: The Xerces Society for Invertebrate Conservation, retrieved March 24, 2011 
  2. ^ Dogterom, Margeriet (2002). Pollination with Mason Bees. Beediverse Books. ISBN 978-0968935705. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: In subgenus Osmia. The American species were revised by Rust (1974). Two distinct subspecies separated by the 100th Meridian have been described: the eastern O. lignaria lignaria and the western O. lignaria propinqua. Intermediate forms have been found in Arizona (Bosch and Kemp 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!