Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia caerulescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCTGGAATAATTGGATCAGCTATAAGAATTATTATTCGAATAGAACTAAGAATTCCCGGATCTTGAATTTCAAATGATCAAGTTTATAATTCTTTAGTAACAGCTCATGCTTTTTTAATAATTTTTTTTTTAGTTATACCATTTTTAATTGGGGGATTTGGAAATTGATTAATTCCATTAATATTAGGAATTCCTGATATAGCTTTTCCCCGAATAAATAATATTAGATTTTGACTTTTACCTCCTTCTTTAATTTTATTAATCTTTAGAAATTTTTTAAATCCTAGACCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCTTCTCATTTATATCATTCTTCTCCCTCAGTTGATTTAGCAATTTTTTCTTTACATATTTCTGGATTATCCTCTATTATAGGTTCATTAAATTTTATTGTTACTATTATTATAATAAAAAATATTTCATTAAAACATATTCAATTACCTCTTTTTCCTTGATCTGTTTTTATTACAACTATTTTATTATTATTTTCTTTACCTGTCTTAGCTGGGGCAATTACTATATTATTATTTGATCGAAATTTTAACACTTCTTTTTTTGATCCAATTGGAGGTGGGGACCCAATTTTATATCAACATCTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Osmia caerulescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!