Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The native range is apparently most of Europe and the North African coast east to about India. Mitchell (1962) states Minnesota to Nova Scotia, south to Illinois and North Carolina and does not indicate that this species is introduced in North America. The Discover Life website's map also indicates Georgia, South Carolina, Nebraska, and Newfoundland with no locality information given, as well as mostly recent records from southern British Columbia to Corvallis, Oregon and Idaho (no locality given), which are presumably from introduced populations before 1962. The BugGuide.net website unequivocally states that the species is recently introduced from the Palearctic. However, many records upon which the Discover Life map is based are from specimens collected between 1935 and 1945, and a few earlier, plus it was already widespread in Mitchell's time. This bee has also been introduced to New Zealand.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Assumed to still be widespread in its native range, and it probably still is in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia caerulescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCTGGAATAATTGGATCAGCTATAAGAATTATTATTCGAATAGAACTAAGAATTCCCGGATCTTGAATTTCAAATGATCAAGTTTATAATTCTTTAGTAACAGCTCATGCTTTTTTAATAATTTTTTTTTTAGTTATACCATTTTTAATTGGGGGATTTGGAAATTGATTAATTCCATTAATATTAGGAATTCCTGATATAGCTTTTCCCCGAATAAATAATATTAGATTTTGACTTTTACCTCCTTCTTTAATTTTATTAATCTTTAGAAATTTTTTAAATCCTAGACCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCTTCTCATTTATATCATTCTTCTCCCTCAGTTGATTTAGCAATTTTTTCTTTACATATTTCTGGATTATCCTCTATTATAGGTTCATTAAATTTTATTGTTACTATTATTATAATAAAAAATATTTCATTAAAACATATTCAATTACCTCTTTTTCCTTGATCTGTTTTTATTACAACTATTTTATTATTATTTTCTTTACCTGTCTTAGCTGGGGCAATTACTATATTATTATTTGATCGAAATTTTAACACTTCTTTTTTTGATCCAATTGGAGGTGGGGACCCAATTTTATATCAACATCTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Osmia caerulescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Apparently this is still a widespread and adaptable bee in the Palearctic, at least in Europe and the Middle East. It appears to be declining in eastern North America, where is was apparently introduced before the 1930s, but is probably expanding on the West Coast, where it was introduced much later. Also established in New Zealand. The species appears to be a G5, although information from its native range was not evaluated in detail. This species is not of conservation concern in North America because it is not native.

Other Considerations: Reported from Maine but not by Adamson (2011) from Virginia or Tuell et al.. (2009) for Michigan. Probably still expanding its range in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Unknown

Comments: Information from the Europe etc. was not evaluated in any detail. The species appears to have declined in eastern North America, but it apparently is not native there. Discover Life account includes a comment that this species is associated with urban areas but that it has declined or disappeared from southern portions of its North American range. All but two of about 25 eastern localities on the range map from the Virginias northward that were checked are based on pre-1950 specimens or (about half) no details were given. Post 2000 records included Nova Scotia and West Virginia. This is an unusually low proportion of modern records. On the other hand it now has a significant range along the west coast with four dates from 1962 to 2003 in Washington and Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No information on threats from native range was evaluated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Osmia caerulescens, not "coerulescens" is the correct spelling (Jordi Bosch, pers. comm., 2010). Spelled "coerulescens" by Sandhouse (1939) and Mitchell (1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!