Overview

Comprehensive Description

Nesting Biology

Nest in holes in wood blocks or pithy stems. Nest plugs and partitions are made with leaf pulp or mastic mixed wood chips from cavity interior (Cane et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Gonzalez Betancourt, Victor Hugo

Source: Anthophila – an online repository of bee diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) British Columbia and the Yukon to Nova Scotia and the New England states, south to southern New Mexico and at least Tulare County, California in the West. Also widespread in the East but essentially a mountain species south of Maryland and Delaware, but it does reach northern Georgia. Absent from most of the Midwest, southern Plains, and eastern portions of Colorado through most or all of Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Type Information

Holotype for Osmia bucephala Cresson, 1864
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Locality: Brit. Amer., Unknown, Canada
  • Holotype: 1864. Proceedings of the Entomological Society of America. 2: 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Reported from a wide array of flowers (e.g. Mitchell, 1962), but like many Osmia often visits blueberry

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: A guess based on the vast range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology of pollination- changes in recent decades

Seasonal temperature changes are an important factor in determining when plants come into bloom. If there are significant changes in annual temperature cycles over time, the blooming schedule can be altered worldwide. This begs an important question for plant pollination. Have the insects and other animals that service animal-pollinated plants altered their behavioral calendar in a similar way?

Using historical museum datasets and recent bee-monitoring data, North American researchers have examined this question in ten species of wild bees: Colletes inaequalis, Andrena crataegi, Andrena carlini, Andrena miserabilis, Osmia pumila, Osmia bucephala, Osmia atriventris, Osmia lignaria, Bombus impatiens, and Bombus bimaculatus. Over the past 130 years, there has been a significant shift toward emergence earlier in the Spring among these bees, which average approximately ten days earlier now than in the late 1800s. This trend was most pronounced in the last forty years.(Bartomeus et al, 2011)

Does this shift resemble a shift in the bloom schedule of the plants these bees visit? Changes in plant bloom times in response to climate change have been a subject of intensive study recently and data is available through several studies of native plants in North America, from herbarium records and monitoring programs (Miller-Rushing et al, 2006; Primack et al, 2004; Bradley et al, 1999; Cook et al, 2008). Among 106 native plants that are visited by these ten bee species, there is also a significant trend toward earlier flowering. This trend also became more pronounced in the last forty years.(Bartomeus et al, 2011)

Do these two shifts mean that bees will continue to be active during appropriate periods to take advantage of the bloom calendar? That is difficult to say. Emergence and bloom dates are quite variable, and all ten of these bee species visit many different species of plant, which have different bloom calendars. Another important research question: do schedule shifts also correspond for specialist plant-pollinator pairs, where a single species of animal visits a single species of plant?

  • Ignasi Bartomeusa, John S. Ascherb, David Wagnerc, Bryan N. Danforthd, Sheila Collae, Sarah Kornbluthb, and Rachael Winfreea. 2011. Climate-associated phenological advances in bee pollinators and bee-pollinated plants. Proceedings of the National Academy of Science, 108(51): 20645-20649
  • Miller-Rushing AJ, Primack RB, Primack D, Mukunda S. 2006. Photographs and herbarium specimens as tools to document phenological changes in response to global warming. Am J Bot 93:1667–1674.
  • Primack D, Imbres C, Primack RB, Miller-Rushing AJ, Del Tredici P. 2004. Herbarium specimens demonstrate earlier flowering times in response to warming in Boston. Am J Bot 91:1260–1264.
  • Bradley NL, Leopold AC, Ross J, Huffaker W. 1999. Phenological changes reflect climate change in Wisconsin. Proc Natl Acad Sci USA 96:9701–9704.
  • Cook BI, Cook ER, Huth PC, Thompson JE, Smiley D. 2008. A cross-taxa phenological dataset from Mohonk Lake, NY and its relationship to climate. Int J Climatol 1383: 1369–1383.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia bucephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCAGGTATAATTGGTTCAGCAATAAGAATTATTATTCGAATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGACCAAGTTTATAATTCTTTAGTAACTGCTCATGCTTTTTTAATAATTTTTTTTTTAGTAATACCATTTTTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATATCATTTCCACGAATAAATAATATTAGATTTTGATTATTACCTCCATCTTTAATACTTTTACTTTTAAGAAATTTTTTAAATCCAAGTCCAGGAACTGGTTGAACTGTTTATCCTCCTCTTTCTACTCATTTATTTCATTCTTCTCCTTCAGTAGATATAGCTATTTTTTCTTTACATATTTCTGGTTTATCTTCTATTATAGGATCGTTAAATTTTATTGTTACAATCATTATAATAAAAAATATTTCTTTAAAACATATTCAATTACCTTTATTTCCCTGATCAGTTTTTATTACTACTATTTTATTACTTTTTTCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCCACAGGAGGTGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Osmia bucephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in both the East and central and western Colorado westward, has turned up in inventories where it would be expected.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Moderate to broad.

Comments: Possibly has somewhat specific needs for nesting habitats (nests in dead wood), but otherwise a generalist.

Other Considerations: Among evidence for this being a common and widespread bee, it is reported from 23 counties in Colorado by Scott et al. (2011). It is also one of only two species of Osmia that was reported by all three of these major sampling efforts: Stubbs et al. (1997) in Maine, Tuell et al. (2009) in southern Michigan, and Sampson (2011) in southwestern Virginia. It also ranges across a large area of sparsely populated northern Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10-25% to decline of 50%

Comments: No real information but no reports of decline, species is adaptable, including to some agricultural systems. Presumed more or less stable. Turns up in inventories in which it would be expected.

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in subgenus Centrosmia by Krombein et al. (1979). Michener (2000) considered Centrosmia an "artificial assemblage of species" and included Centrosmia, Chenosmia, Monilosmia, and Nothosmia in Melanosmia. Sandhouse (1939) revised the Nearctic species, mostly under the subgeneric name Nothosmia; Sinha and Michener (1958) revised species then placed in Centrosmia. There are two subspecies according to Mitchell (1962); O. b. bucephala and O. b. subornata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!