Overview

Brief Summary

This megachilid bee is widespread in Eastern North America and is an effective pollinator of blueberry. It has been evaluated for commercial use and is occasionally used as a managed blueberry pollinator. (Drummond and Stubbs, 1997)

Females are solitary and nest above ground, in raspberry or blackberry cane, or in burrows in wood previously dug by other insects. (They take well to artificial wooden nesting blocks with holes drilled in them.) They seal their nests with plant fiber which they chew to a pulp. (UMaine Extension No. 2420)

Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Nesting Biology

Nest in holes in wood blocks or pithy stems. Nest plugs and partitions are made with leaf pulp or mastic (Cane et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Gonzalez Betancourt, Victor Hugo

Source: Anthophila – an online repository of bee diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Lectotype for Osmia atriventris Cresson, 1864
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Locality: Connecticut, United States
  • Lectotype: 1864. Proceedings of the Entomological Society of America. 2: 29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Osmia atriventris in Illinois

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology of pollination- changes in recent decades

Seasonal temperature changes are an important factor in determining when plants come into bloom. If there are significant changes in annual temperature cycles over time, the blooming schedule can be altered worldwide. This begs an important question for plant pollination. Have the insects and other animals that service animal-pollinated plants altered their behavioral calendar in a similar way?

Using historical museum datasets and recent bee-monitoring data, North American researchers have examined this question in ten species of wild bees: Colletes inaequalis, Andrena crataegi, Andrena carlini, Andrena miserabilis, Osmia pumila, Osmia bucephala, Osmia atriventris, Osmia lignaria, Bombus impatiens, and Bombus bimaculatus. Over the past 130 years, there has been a significant shift toward emergence earlier in the Spring among these bees, which average approximately ten days earlier now than in the late 1800s. This trend was most pronounced in the last forty years.(Bartomeus et al, 2011)

Does this shift resemble a shift in the bloom schedule of the plants these bees visit? Changes in plant bloom times in response to climate change have been a subject of intensive study recently and data is available through several studies of native plants in North America, from herbarium records and monitoring programs (Miller-Rushing et al, 2006; Primack et al, 2004; Bradley et al, 1999; Cook et al, 2008). Among 106 native plants that are visited by these ten bee species, there is also a significant trend toward earlier flowering. This trend also became more pronounced in the last forty years.(Bartomeus et al, 2011)

Do these two shifts mean that bees will continue to be active during appropriate periods to take advantage of the bloom calendar? That is difficult to say. Emergence and bloom dates are quite variable, and all ten of these bee species visit many different species of plant, which have different bloom calendars. Another important research question: do schedule shifts also correspond for specialist plant-pollinator pairs, where a single species of animal visits a single species of plant?

  • Ignasi Bartomeusa, John S. Ascherb, David Wagnerc, Bryan N. Danforthd, Sheila Collae, Sarah Kornbluthb, and Rachael Winfreea. 2011. Climate-associated phenological advances in bee pollinators and bee-pollinated plants. Proceedings of the National Academy of Science, 108(51): 20645-20649
  • Miller-Rushing AJ, Primack RB, Primack D, Mukunda S. 2006. Photographs and herbarium specimens as tools to document phenological changes in response to global warming. Am J Bot 93:1667–1674.
  • Primack D, Imbres C, Primack RB, Miller-Rushing AJ, Del Tredici P. 2004. Herbarium specimens demonstrate earlier flowering times in response to warming in Boston. Am J Bot 91:1260–1264.
  • Bradley NL, Leopold AC, Ross J, Huffaker W. 1999. Phenological changes reflect climate change in Wisconsin. Proc Natl Acad Sci USA 96:9701–9704.
  • Cook BI, Cook ER, Huth PC, Thompson JE, Smiley D. 2008. A cross-taxa phenological dataset from Mohonk Lake, NY and its relationship to climate. Int J Climatol 1383: 1369–1383.
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia atriventris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCAGGAATAATTGGTTCAGCAATAAGAATTATTATTCGAATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGATCAAACTTATAATTCTTTAGTTACTGCTCATGCTTTTTTAATAATTTTTTTCTTAGTTATACCATTCTTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCATTTCCACGAATAAATAATATTAGATTTTGACTTTTACCTCCTTCTTTAATACTTTTATTATTAAGAAATTTTATAAATCCTAGTCCAGGAACTGGATGAACTGTTTATCCACCTTTATCTTCTCATTTATTTCATTCTTCTCCTTCAGTTGATATAGCTATTTTTTCTTTACATATTTCTGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAACATATTCAATTACCTTTATTTCCTTGATCTGTCTTTATTACTACTATTTTATTACTTTTTTCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCCACAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Osmia atriventris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Osmia atriventris


Osmia atriventris, sometimes referred to as the Maine blueberry bee, is a megachilid bee native to eastern North America from Nova Scotia to Alberta in the north, and Iowa to Georgia in the south. This solitary bee normally gathers pollen from many different flowers, but will pollinate blueberries, and is sometimes used commercially for this purpose.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!