Overview

Comprehensive Description

Nesting Biology

Nest in holes in wood blocks or pithy stems. Nest plugs and partitions are made with leaf pulp or mastic (Cane et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Gonzalez Betancourt, Victor Hugo

Source: Anthophila – an online repository of bee diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Older literature indicates Alberta to Nova Scotia, south to Iowa, Tennessee and Georgia. The Discover Life map is similar, with many records from Nova Scotia and central Quebec to southern Manitoba, North Dakota, Wisconsin, Missouri, and northern Mississippi; in the east south in the coastal plain, piedmont, and mountains to southeastern North Carolina and Augusta Georgia. Reportedly Florida (but no details available). Scattered northern records to Alberta.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Type Information

Lectotype for Osmia atriventris Cresson, 1864
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Locality: Connecticut, United States
  • Lectotype: 1864. Proceedings of the Entomological Society of America. 2: 29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Osmia atriventris in Illinois

Osmia atriventris Cresson: Megachilidae (Osmiini), Hymenoptera
(observations are from Robertson, Graenicher, Crosswhite & Crosswhite, Steury et al., and Grundel et al.)

Amaryllidaceae: Hypoxis hirsuta cp (Rb); Apiaceae: Erigenia bulbosa sn (Rb), Zizia aurea sn cp (Rb); Asteraceae: Aster furcatus sn (Gr), Aster macrophyllus sn (Gr), Erigeron philadelphicus sn cp (Gr); Boraginaceae: Lithospermum canescens sn cp fq (Rb), Mertensia virginica sn cp (Rb); Brassicaceae: Arabis shortii sn (Rb), Cardamine bulbosa sn fq (Rb); Caprifoliaceae: Lonicera dioica sn np (Gr), Lonicera canadensis sn (Gr), Lonicera oblongifolia sn (Gr), Symphoricarpos occidentalis sn (Gr); Caryophyllaceae: Cerastium arvense (SDO); Fabaceae: Astragalus crassicarpus trichocalyx sn cp (Rb), Cercis canadensis sn cp (Rb), Trifolium reflexum sn (Rb), Trifolium repens sn cp fq (Rb), Orbexilum onobrychis sn (Rb); Geraniaceae: Geranium maculatum sn (Rb); Hydrophyllaceae: Ellisia nyctelea sn cp (Rb); Liliaceae: Nothoscordum bivalve sn (Rb), Uvularia grandiflora sn (Rb); Polemoniaceae: Polemonium reptans sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Rosaceae: Fragaria virginiana sn cp (Rb), Porteranthus stipulatus sn (Rb), Rubus flagellaris sn cp (Rb, SDO); Salicaceae: Salix discolor [unsp sn] (Gr); Scrophulariaceae: Collinsia verna sn cp fq (Rb), Penstemon gracilis gracilis (CC), Penstemon gracilis wisconsinensis (CC), Penstemon hirsutus sn cp fq (Rb), Penstemon pallidus (CC); Violaceae: Viola pedata (Gnd), Viola pubescens sn cp fq (Rb), Viola striata sn cp (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Osmia atriventris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCAGGAATAATTGGTTCAGCAATAAGAATTATTATTCGAATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGATCAAACTTATAATTCTTTAGTTACTGCTCATGCTTTTTTAATAATTTTTTTCTTAGTTATACCATTCTTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCATTTCCACGAATAAATAATATTAGATTTTGACTTTTACCTCCTTCTTTAATACTTTTATTATTAAGAAATTTTATAAATCCTAGTCCAGGAACTGGATGAACTGTTTATCCACCTTTATCTTCTCATTTATTTCATTCTTCTCCTTCAGTTGATATAGCTATTTTTTCTTTACATATTTCTGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAACATATTCAATTACCTTTATTTCCTTGATCTGTCTTTATTACTACTATTTTATTACTTTTTTCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCCACAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Osmia atriventris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Although threats have not been widely evaluated, and old versus new collections frequency has not been compared, no pervasive threats are known. No reports of a major decline of this species were found and it has a very large range and occurs in many kinds of habitats including blueberry farms. This species is a common pollinator of commercial highbush blueberry in Michigan and a known one of lowbush blueberry in Maine (Tuell et al., 2009, Stubbs et al., 1997), and it has also been found visiting commercial highbush blueberry in southwestern Virginia (Adamson, 2011). It is not imminently imperiled, and probably common in much of its range at least northward.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Moderate to broad.

Comments: Reports from a variety of flowers (Mitchell, 1962). No known unusual nesting requirements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Several to very many (4 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Osmia atriventris


Osmia atriventris, sometimes referred to as the Maine blueberry bee, is a megachilid bee native to eastern North America from Nova Scotia to Alberta in the north, and Iowa to Georgia in the south. This solitary bee normally gathers pollen from many different flowers, but will pollinate blueberries, and is sometimes used commercially for this purpose.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in subgenus Chenosmia by Krombein et al. (1979). Michener (2000) included Centrosmia, Chenosmia, Monilosmia, and Nothosmia in Melanosmia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!