Megachile centuncularis — Details

A Leaf-cutter Bee learn more about names for this taxon

EOL is scheduled for maintenance on Thursday, June 20 between 8:00 and 10:00 AM EDT.
During this time you may find changes in EOL's performance and availability.

Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Megachile centuncularis in Illinois

Megachile centuncularis Linnaeus: Megachilidae (Megachilini), Hymenoptera
(observations are from Robertson, Graenicher, Mitchell, and Guignard)

Asclepiadaceae: Asclepias sullivanti dead (Rb); Asteraceae: Achillea millefolium sn cp (Gr), Ageratina altissima sn cp (Gr), Anthemis cotula sn cp (Gr), Arctium lappa sn cp (Gr), Arctium minus sn cp (Rb), Aster drummondii sn cp (Gr), Aster furcatus cp (Gr), Aster laevis sn cp (Gr), Aster lateriflorus sn (Gr), Aster macrophyllus sn cp (Gr), Aster novae-angliae sn cp (Gr), Aster prenanthoides sn cp (Gr), Aster puniceus sn cp (Gr), Bidens bipinnata sn cp (Rb), Cirsium arvense sn (Gr), Erigeron philadelphicus sn cp (Gr), Eupatoriadelphus purpureus sn (Gr), Eupatorium perfoliatum sn cp (Gr), Euthamia graminifolia sn (Gr), Helenium autumnale sn cp (Gr), Helianthus strumosus sn cp (Gr), Heliopsis helianthoides sn cp (Gr), Leucanthemum vulgare sn cp (Gr), Ratibida pinnata sn cp (Gr), Rudbeckia laciniata sn (Gr), Solidago canadensis sn cp (Gr), Solidago juncea sn cp (Gr), Tanacetum vulgare sn cp (Gr); Fabaceae: Astragalus canadensis sn (Rb), Trifolium repens sn (Rb); Lamiaceae: Nepeta cataria sn (Rb); Liliaceae: Allium cernuum sn (Gr), Asparagus officinalis sn cp fq (Rb, Gr); Onagraceae: Epilobium angustifolium (Mch); Orchidaceae: Cypripedium reginae exp (Gu); Rosaceae: Crataegus crus-galli sn (Rb), Rubus allegheniensis sn (Rb); Scrophulariaceae: Scrophularia marilandica sn (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megachile centuncularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTATATATATAATATTTGCATTATGATCTGGAATAATTGGTTCAAGAATATCAATAATTATTCGAATAGAATTAAGAACACCAGGATCCTGAATCAAAAATGATCAAATTTATAATTCTATTGTCACAGCTCATGCATTTTTAATAATCTTTTTTTTAGTAATACCATTTATAATTGGTGGATTTGGTAATTGATTAATACCATTAATAATTGGAGCTCCAGATATAGCTTTTCCACGAATAAATAATGTAAGATTTTGATTTTTACCTCCATCTTTAATCTTACTATTATCTAGAAATTTAATTAATCCAAGACCAGGAACTGGATGAACTGTATACCCCCCCTTATCATTATACATATTTCATCCATCCCCTTCAGTTGATTTGACAATTTTTTCACTTCATTTATCTGGAATTTCATCAATTATTGGATCATTAAATTTTATAGTAACAATTTTATTAATAAAAAATTACTCCTTAAATTATAGAAAAGTAACATTATTCCCATGATCAGTTTTTATTACAACAATATTACTTTTATTGTCATTACCAGTTTTAGCAGGTGCAATTACAATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGATCCAATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Megachile centuncularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!