Overview
Distribution
National Distribution
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
© NatureServe
Source:
NatureServe
Trusted
Ecology
Associations
Flowering Plants Visited by Megachile centuncularis in Illinois
Megachile centuncularis Linnaeus: Megachilidae (Megachilini), Hymenoptera
(observations are from Robertson, Graenicher, Mitchell, and Guignard)
Asclepiadaceae: Asclepias sullivanti dead (Rb); Asteraceae: Achillea millefolium sn cp (Gr), Ageratina altissima sn cp (Gr), Anthemis cotula sn cp (Gr), Arctium lappa sn cp (Gr), Arctium minus sn cp (Rb), Aster drummondii sn cp (Gr), Aster furcatus cp (Gr), Aster laevis sn cp (Gr), Aster lateriflorus sn (Gr), Aster macrophyllus sn cp (Gr), Aster novae-angliae sn cp (Gr), Aster prenanthoides sn cp (Gr), Aster puniceus sn cp (Gr), Bidens bipinnata sn cp (Rb), Cirsium arvense sn (Gr), Erigeron philadelphicus sn cp (Gr), Eupatoriadelphus purpureus sn (Gr), Eupatorium perfoliatum sn cp (Gr), Euthamia graminifolia sn (Gr), Helenium autumnale sn cp (Gr), Helianthus strumosus sn cp (Gr), Heliopsis helianthoides sn cp (Gr), Leucanthemum vulgare sn cp (Gr), Ratibida pinnata sn cp (Gr), Rudbeckia laciniata sn (Gr), Solidago canadensis sn cp (Gr), Solidago juncea sn cp (Gr), Tanacetum vulgare sn cp (Gr); Fabaceae: Astragalus canadensis sn (Rb), Trifolium repens sn (Rb); Lamiaceae: Nepeta cataria sn (Rb); Liliaceae: Allium cernuum sn (Gr), Asparagus officinalis sn cp fq (Rb, Gr); Onagraceae: Epilobium angustifolium (Mch); Orchidaceae: Cypripedium reginae exp (Gu); Rosaceae: Crataegus crus-galli sn (Rb), Rubus allegheniensis sn (Rb); Scrophulariaceae: Scrophularia marilandica sn (Rb)
(observations are from Robertson, Graenicher, Mitchell, and Guignard)
Asclepiadaceae: Asclepias sullivanti dead (Rb); Asteraceae: Achillea millefolium sn cp (Gr), Ageratina altissima sn cp (Gr), Anthemis cotula sn cp (Gr), Arctium lappa sn cp (Gr), Arctium minus sn cp (Rb), Aster drummondii sn cp (Gr), Aster furcatus cp (Gr), Aster laevis sn cp (Gr), Aster lateriflorus sn (Gr), Aster macrophyllus sn cp (Gr), Aster novae-angliae sn cp (Gr), Aster prenanthoides sn cp (Gr), Aster puniceus sn cp (Gr), Bidens bipinnata sn cp (Rb), Cirsium arvense sn (Gr), Erigeron philadelphicus sn cp (Gr), Eupatoriadelphus purpureus sn (Gr), Eupatorium perfoliatum sn cp (Gr), Euthamia graminifolia sn (Gr), Helenium autumnale sn cp (Gr), Helianthus strumosus sn cp (Gr), Heliopsis helianthoides sn cp (Gr), Leucanthemum vulgare sn cp (Gr), Ratibida pinnata sn cp (Gr), Rudbeckia laciniata sn (Gr), Solidago canadensis sn cp (Gr), Solidago juncea sn cp (Gr), Tanacetum vulgare sn cp (Gr); Fabaceae: Astragalus canadensis sn (Rb), Trifolium repens sn (Rb); Lamiaceae: Nepeta cataria sn (Rb); Liliaceae: Allium cernuum sn (Gr), Asparagus officinalis sn cp fq (Rb, Gr); Onagraceae: Epilobium angustifolium (Mch); Orchidaceae: Cypripedium reginae exp (Gu); Rosaceae: Crataegus crus-galli sn (Rb), Rubus allegheniensis sn (Rb); Scrophulariaceae: Scrophularia marilandica sn (Rb)
-
Hilty, J. Editor. 2013. Insect Visitors of Illinois Wildflowers. World Wide Web electronic publication. illinoiswildflowers.info, version (05/2013)
See: Abbreviations for Insect Activities, Abbreviations for Scientific Observers, References for behavioral observations
© John Hilty
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Megachile centuncularis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AATTATATATATAATATTTGCATTATGATCTGGAATAATTGGTTCAAGAATATCAATAATTATTCGAATAGAATTAAGAACACCAGGATCCTGAATCAAAAATGATCAAATTTATAATTCTATTGTCACAGCTCATGCATTTTTAATAATCTTTTTTTTAGTAATACCATTTATAATTGGTGGATTTGGTAATTGATTAATACCATTAATAATTGGAGCTCCAGATATAGCTTTTCCACGAATAAATAATGTAAGATTTTGATTTTTACCTCCATCTTTAATCTTACTATTATCTAGAAATTTAATTAATCCAAGACCAGGAACTGGATGAACTGTATACCCCCCCTTATCATTATACATATTTCATCCATCCCCTTCAGTTGATTTGACAATTTTTTCACTTCATTTATCTGGAATTTCATCAATTATTGGATCATTAAATTTTATAGTAACAATTTTATTAATAAAAAATTACTCCTTAAATTATAGAAAAGTAACATTATTCCCATGATCAGTTTTTATTACAACAATATTACTTTTATTGTCATTACCAGTTTTAGCAGGTGCAATTACAATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGATCCAATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Megachile centuncularis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 24
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 24
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Conservation Status
National NatureServe Conservation Status
United States
Rounded National Status Rank: NNR - Unranked
© NatureServe
Source:
NatureServe
Trusted
NatureServe Conservation Status
Rounded Global Status Rank: GNR - Not Yet Ranked
© NatureServe
Source:
NatureServe
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
