Molecular Biology and Genetics

Molecular Biology

Barcode data: Colostygia aptata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGACTCGTACCTTTAATATTAGGGGCTCCTGATATAGCATTTCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTACTCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCCGGTACAGGATGAACTGTTTACCCACCTTTATCTTCTAATATTGCTCATGGTGGAAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAACTTTATTACTACTATTATCAATATACGATTAAATAATATATTTTTTGATCAATTGCCTTTATTTGTTTGATCAGTAGGAATTACAGCATTTTTACTACTTTTATCACTACCAGTGTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCGGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colostygia aptata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Colostygia aptata

Colostygia aptata is a moth of the Geometridae family. It is found in most of the Palearctic ecozone.

The wingspan is 20–25 mm. Adults are in wing from July to August.

The larva feed on Galium species. Larvae can be found from August to June. It overwinters in the larval stage.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!