Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962): Nest architecture is Type IIIb: Lateral burrows are very short or absent such that cells are almost attached to the burrow walls at a right angle. The cells are not spatially concentrated in any part of the burrow, and are at the end of long galleries.

The nesting biology of Lasioglossum villosulum is reviewed by Plateaux-Quénu (2008). Females produced at the end of summer mate with males and then overwinter (the males die before winter). These females then initiate new nests the following spring. They produce one generation of offspring that emerges early in the summer. Females of this generation mate and initiate their own nests. Offspring of the summer nests emerge late in the summer, and become the overwintering females for the next year. Thus, although this species raises two generations of offspring, it is not social because the offspring disperse away from the nest.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lasioglossum villosulum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lasioglossum villosulum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGCTATATGAGCAGGAATAATTGGAGCATCATTAAGAATAATTATTCGAATAGAATTAAGAGTACCAGGAAGATGAATTAATAATGATCAAATTTATAATACTATTATTACCTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCTTTATAATTGGGGGATTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTAATTCCATCTTTATTTATATTATTAATAAGAAGTATTTTAGCTTCTGGATCAGGTACAGGATGAACAATTTATCCTCCTTTATCATCTATTATATATCATTCATCAATCTCTGTAGATTGTACTATTTTTTCATTACATATTGCAGGAATTTCTTCAATTATAGGAGCCATTAATTTTATTGTATCTATTTTATTAATAAAAAATATTTCCATTAATTATGATCAAATTCCATTATTCCCCTGATCAGTAAAAATTACTGCTATTTTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAACACTTCATTTTTTGATCCATCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!