Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962). From Sakagami and Michener (1962): Nest architecture is Type IIIb: Lateral burrows are very short or absent such that cells are almost attached to the burrow walls at a right angle. The cells are not spatially concentrated in any part of the burrow. Sometimes a cavity surrounds the cells. Or nest architecture is Type IVb: Lateral burrows are very short or absent such that cells are almost attached to the burrow wall at a right angle. The cells are clustered against one wall and surrounded by a cavity created by burrowing around the entire cell cluster.

Plateaux-Quenu (2008) reviews the social behavior of Lasioglossum pauxillum. This species, which is widespread in the western paleartic, has two worker broods in the spring and summer. These are followed by a reproductive brood of males and females that will overwinter to be new nest foundresses the following spring. This species is thus eusocial, with reproductive queens and non-reproductive workers. Queens are generally larger than workers, although there is some overlap. Also, some males (~5% of brood) are produced along with the female worker brood. This species opens its cells to check on brood after oviposition.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasioglossum pauxillum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATATAAGATTTTGATTACTTATTCCATCACTATTTATACTTTTAATAAGAAGAATTTTAGCATCTGGTTCAGGAACTGGATGAACTATTTACCCTCCTTTATCTTCTTCAACTTTTCACCCATCTATTTCTACAGATTGTACAATTTTTTCTTTACATATTGCTGGTATTTCATCTATCATAGGAGCTATTAATTTTATTGTATCAATTATATTAATAAAAAATATTTCTATTAATTATGATCAAATTCCTCTTTTCCCATGATCAGTAAAAATTACTGCTATCTTATTATTACTCTCTCTACCCGTTTTAGCCGGAGCTATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTATATATTTTAATTTTACCTGGATTTGGATTAATTTCCCATATTATTTTTAATGAAAGAGGAAAAAAAGAAATTTTTGGAAATTTAGGAATAATTTATGCTATATTAGGAATTGGATTTTTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGTATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lasioglossum pauxillum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!