Overview

Comprehensive Description

Lasioglossum morio (Fabricius, 1793)

Materials

Type status: Other material. Occurrence: occurrenceRemarks: on Gentiana acaulis L.; recordedBy: S. Bossert ; individualCount: 1 ; sex: 1 female; Location: country: Austria ; stateProvince: Tyrol; locality: Zemmgrund ; verbatimElevation: 2120 m; decimalLatitude: 47.028004 ; decimalLongitude: 11.822377 ; Event: samplingProtocol: manual catch ; eventDate: 07-08-12 ; habitat: alpine meadow

Type status: Other material. Occurrence: occurrenceRemarks: on Leontodon hispidus; recordedBy: S. Bossert ; individualCount: 1 ; sex: 1 female; Location: country: Austria ; stateProvince: Tyrol; locality: Zemmgrund ; verbatimElevation: 2072 m; decimalLatitude: 47.025460 ; decimalLongitude: 11.815305 ; Event: samplingProtocol: manual catch ; eventDate: 07-07-12 ; habitat: alpine meadow

Distribution

Western Palaearctic ( Ebmer 1988 ).

  • Bossert, Silas (2014): The high alpine bee fauna (Hymenoptera: Apoidea) of the Zillertal Alps, Austria. Biodiversity Data Journal 2, 1115: 1115-1115, URL:http://dx.doi.org/10.3897/BDJ.2.e1115
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This bee is very common in Europe and able to adapt to a wide variety of habitats. Nevertheless, other than the statement that "it is social" by Knerer, quoted by Ebmer et al. (1994), its social biology and nest architecture has not been described.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / kleptoparasite
larva of Sphecodes niger kleptoparasitises pollen store of Lasioglossum morio

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasioglossum morio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTCATATTATTAATAAGAAGAATTTTATCATCAGGATCAGGAACAGGATGAACAGTTTACCCTCCATTATCTTCAATTACATACCATTCATCTATTTCTGTAGATTGCACTATCTTTTCATTACACATTGCTGGAATCTCATCCATTATAGGAGCTATTAATTTTATTGTTTCAATTATATTAATAAAAAATATTTCAATCAATTATGATCAAATTCCATTATTCCCATGATCAGTAAAAATTACAGCTATCCTTTTACTTTTATCTTTACCCGTATTAGCCGGAGCTATTACTATATTATTAACAGATCGAAACTTAAACACTTCATTTTTTGACCCCTCAGGGGGAGGAGACCCAATTCTTTACCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTCTACCTGGATTTGGCCTAATTTCACATATTATTTTTAATGAAAGAGGAAAAAAAGAAATTTTTGGAAACTTAGGAATAATTTACGCAATATTAGGAATTGGATTTTTAGGGTTCATTGTATGAGCACATCATATATTTACTGTAGGATTAGATGTAGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasioglossum morio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!