Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Lasioglossum coreopsis in Illinois

Lasioglossum coreopsis Robertson: Halictidae (Halictinae), Hymenoptera
(observations are from Robertson, Mitchell, and Moure & Hurd)

Alismataceae: Alisma plantago-aquatica sn (Rb); Apiaceae: Eryngium yuccifolium (Mch), Zizia aurea sn (Rb); Asteraceae: Aster novae-angliae cp np (Rb), Aster pilosus sn (Rb), Brickellia eupatorioides (Mch, MH), Coreopsis palmata sn cp fq (Rb), Coreopsis tripteris sn cp (Rb), Krigia biflora sn cp (Rb), Rudbeckia hirta cp (Rb), Rudbeckia subtomentosa sn cp (Rb); Brassicaceae: Capsella bursa-pastoris sn cp (Rb), Lepidium virginicum sn (Rb); Cactaceae: Opuntia humifusa cp (Mch); Caprifoliaceae: Symphoricarpos orbiculatus sn (Rb); Euphorbiaceae: Crotonopsis linearis (MH); Polemoniaceae: Polemonium reptans sn cp (Rb); Rosaceae: Fragaria virginiana (Mch)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasioglossum coreopsis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATACTTTACTTTATTTTTGCAATATGAGCAGGAATAATTGGAGCTTCTTTAAGAATAATTATTCGAATAGAATTAAGTGCTCCTGGAAAATGAATTAATAATGACCAAATCTATAATACTATTATTACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTCGGTAATTGATTAGTCCCTTTAATAATTGGAGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTATTAATCCCATCAATATTTATATTATTAATAAGAAGAATTCTCTCCTCAGGATCAGGAACAGGATGAACAGTTTATCCTCCTTTATCATCTATTATATATCATTCATCAATTTCAGTAGATTACACTATTTTTTCTTTACATATTGCAGGAATTTCATCCATTATAGGTGCTATTAATTTTATTGTATCAATTTTACTTATAAAAAATATTTCAATTAATTATGATCAAATTCCACTATTCCCATGATCAGTAAAAATTACTGCCATTTTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTTCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasioglossum coreopsis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!