Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962): Nest architecture is Type Va: Cells are oriented laterally to the main burrow, and clustered. This cluster is connected to the main burrow by a lateral burrow. The cluster is incompletely surrounded by a cavity created by burrowing around the cluster. Nests are known from both flat ground and banks. Nests, but not cells, are re-used by subsequent generations. Nest aggregation information: 1,000 in 10 square meters. This bee's social biology is described by Wcislo (1997): Is solitary at high altitudes in Japan, but eusocial at lower altitudes in Japan and elsewhere in Europe.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lasioglossum calceatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lasioglossum calceatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATATAAGATTATGATTATTAATACCATCATTATTTATACTATTAATAAGAAGATTATTATCCTCAGGATCAGGAACTGGATGAACAATTTACCCACCATTATCTAACTCTACTTTTCATCCATCAATCTCAGTAGATTGCACAATTTTTTCATTACATATTGCAGGAATTTCATCCATTATAGGAGCTATTAATTTTATTGTATCAATTATACTAATAAAAAATATATCTATTAACTATGATCAAATTCCTCTTTTTCCATGATCAGTAAAAATTACAGCCATCCTTCTTCTACTATCATTACCAATTTTAGCTGGAGCCATTACAATACTTTTAACAGATCGAAATATAAATACTTCATTTTTTGATCCATCAGGAGGTGGTGATCCTATTTTATATCAACATCTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATCCTTCCAGGATTTGGATTAATTTCACATATTATCTTCAATGAAAGAGGAAAAAAAGAAATTTTTGGAAACTTAGGTATAATTTATGCTATATTAGGTATTGGATTTTTAGGTTTTATTGTATGAGCCCATCACATATTTACTGTTGGATTAGACGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!