Overview

Comprehensive Description

Lasioglossum (Dialictus) asteris is a socially parasitic bee that invades nests of Lasioglossum (Dialictus) imitatum (Smith). Upon gaining entry to the host nest, a female L. asteris dominates the host queen and forces the host worker bees to rear its offspring. The host queen tends to cache pollen and nectar and lay its eggs over this stored food. Parasitic larvae kill the host larvae in order to gain access to the food. (Wcislo 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The host species is far more widespread, but L. asteris is only found from Ontario south to Alabama and west to Kansas (Gibbs 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Succinct:

The females are 3.5 – 4 mm in length and their body is mostly light brown with weak metallic reflections on the thorax. The head is broad with a pair of compound eyes, three simple eyes (ocelli), and two antennae protruding from the head. They have a short, thin pubescence, shiny broad cheeks, and a shiny smooth abdomen. The legs are brownish yellow (Gibbs 2010).

The males are approximately 4 mm in length. The head and dorsum of the thorax have a strong green reflection. It has a thin, obscure body which is entirely pale and appears to be much broader in comparison to its length. The two compound eyes slightly converge from below and there are two antennae protruding from the head that appear to be closer to the eyes (Biodiversity Institute of Ontario 2006).

Identification:

Bees of the subgenus Dialictus (Halictidae: Lasioglossum) are among the most commonly collected bees in North America and they play a major role as pollinators and model organisms (Gibbs 2010). They are small bees (approximately 3.4-8.1 mm) and have dull metallic reflections on the head and mesosoma of most species (Gibbs 2010). They have a strongly arched basal or posterior portion of the basal vein, and weakened distal veins of the fore wing (Gibbs 2010). Characteristics of L. asteris exhibit characteristics such as lack of scopa, enlarged head, scythe-like mandibles, acute pronotal dorsolateral angle and flattened labrum without dorsal keel which are characteristics of social parasites (Gibbs 2010). Females are small in size (4.0-4.6 mm) and have mandibles without a subapical tooth or angle, gena much broader than eye, and imbricate metapostnotum (Gibbs 2010). Males of L. asteris are also fairly small in size and are recognizable by an acute pronotal dorsolateral angle (Gibbs 2010).

Original description:

FEMALE—Length 3.5-4.0 mm.; piceous, with bluish reflections on dorsum of thorax; pubescence very short and thin, entirely pale; head somewhat broader than long; clypeus flat, very broad and short; eyes sub parallel; antennae very slightly nearer each other than to eyes; mandibles elongate, sickle-shaped, entirely simple; cheeks very broad, with a rounded posterior angle opposite middle of eye; face below ocelli shining, punctures exceedingly minute and obscure, well separated, vertex more shining, with punctures more minute and obscure, cheeks polished, with minute and sparse punctures, lower surface shining, hypostomal carinae slightly divergent apically; lower half of face, including clypeus and supraclypeal area, shining, very minutely and rather sparsely punctate; scutum and scutellum polished, punctures very sparse and minute, barely evident even laterally, pleura somewhat less shining, with a few exceedingly minute and obscure punctures evident; entire propodeum smooth and shining, dorsal area without any evident striations; wings whitish hyaline, veins and stigma pale yellowish; tegulae yellowish; legs brownish basally, becoming yellow apically; abdominal terga smooth and shining, with only a few, widely scattered, minute punctures evident on the more apical terga.

MALE—Length 4 mm.; largely piceous but head and dorsum of thorax with strong greenish reflections; pubescence short, thin and obscure, entirely pale, somewhat more copious on head and on thorax ventrally; length and breadth of head subequal; clypeus rather flat, considerably broader than long; eyes very slightly convergent below; antennae considerably nearer eyes than to each other, basal segment of flagellum about as broad as long, only slightly longer than pedicel, length of the following segments about one and one-half times the breadth; cheeks subequal to eyes in width; punctures of face below ocelli deep and distinct, quite coarse but close, becoming minute and obscure on the shining vertex and upper cheeks, lower surface of cheeks shining; lower half of face more shining, sparsely and minutely punctate; scutum and scutellum polished, with widely separated, fine but distinct punctures; pleura shining, with rather coarse and deep, irregularly scattered punctures; dorsal area of propodeum with a few basal, incomplete striations, lateral areas quite smooth; wings hyaline, veins and stigma testaceous; tegulae testaceous; basal segments of legs piceous, tibiae yellowish at base and apex, tarsi entirely yellowish; abdominal terga shining, minutely and rather sparsely punctate, the apical margins rather narrowly depressed and impunctate” (Mitchell 1960).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The host, Lasioglossum imitatum (Smith), is a ground nesting bee that is very abundant in eastern North America (Wcislo 1997). Since L. asteris is parasitic and invades the nests of its host species, it can be said that it also resides in ground nests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Hostplants

Due to its parasitic lifestyle, L. asteris have lost the characteristics required for pollination and do not aid in pollination (Wcislo 1999). Thus, they do not have any specific floral hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Natural Enemies

Natural enemies of sweat bees usually consist of parasitic fungi, nematodes, insects, and mites as well as predatory insects and arachnids (Choe and Crespi 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Lasioglossum asteris is a valuable species for the study of host-parasite relationships (Wcislo 1999) and evolutionary origins of social behavior (Danforth 1999). The behavior of L. asteris closely resembles the social parasitic behaviour of other bee species, polistine wasps, and ants, making investigations of L. asteris behavior helpful for understanding of the behaviour of many other species. Lasioglossum asteris, the social parasite, apparently evolved from within the host clade (Danforth et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Lasioglossum asteris is a social parasite that invades nests of Lasioglossum (Dialictus) imitatum (Smith). The host species tends to place guards at the entrances for protection. Thus, L. asteris females must face aggression from the guards before being able to enter the host’s nest. The host nests have a circular entrance that is slightly larger than the diameter of their heads. Lasioglossum asteris is approximately the same size as the host species, making it easier for them to invade the nest (Wcislo 1997). After invading, L. asteris becomes the reproductively dominant species and forces the host workers to rear its offsprings (Wcislo 1997).

Only the mated L. asteris overwinter in the soil and they become active once the host brood emerges in early July (Wcislo 1997). In a study by Wcislo (1997), individuals of L. asteris were not commonly seen flying around the host nests or in the host nests prior to the pre-emergence stage.

Upon gaining entry to the host nest, parasitic L. asteris dominates the host queen and forces the host worker bees to rear its offspring. The host species tends to cache pollen and nectar and lays its eggs over this food storage. Parasitic larvae kill the host larvae in order to gain access to the food (Wcislo 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

This species was first described by Mitchell (1960) as Paralictus asteris. The genera Paralictus (Robertson 1901) and Dialictus (Robertson 1902) are now considered synonyms (Michener 2007). The latter name has priority despite being a younger name (Michener 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasioglossum asteris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAACAATATAAGATTTTGATTACTTATTCCATCAATATTCATATTATTAATAAGAAGTATCGTATCATCTGGATCAGGAACCGGATGAACTGTTTACCCCCCATTATCTTCAATTATATACCACTCATCAATTTCAGTAGATTACACTATTTTTTCATTACATATCGCAGGAATTTCATCTATTATAGGAGCTATTAACTTTATTGTATCTATCCTACTAATAAAAAATATTTCAATTAACTATGATCAAATTCCCTTATTCCCATGATCAGTAAAAATTACTGCTATTTTATTACTATTATCCTTACCAGTTTTAGCAGGAGCTATCACTATACTTCTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCTTCAGGAGGAGGAGACCCAATTCTTTACCAACATTTATTTTGATTCTTTGGCCACCCAGAAGTTTATATTTTAATTCTACCTGGATTCGGATTAATTTCACATATTATTTTTAATGAAAGAGGAAAAAAAGAAATTTTTGGAAACCTAGGAATAATCTACGCTATATTAGGTATTGGATTTTTAGGATTTATTGTATGAGCTCATCATATATTCACTGTTGGATTAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lasioglossum asteris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

The host species is abundant, but L. asteris is uncommonly collected.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The host species and the habitat are not known to be in danger. As in all bees, their sex determination mechanism results in increased production of sterile or inviable diploid males when populations are small (Zayed and Packer 2005). As social parasites, population sizes of L. asteris are necessarily smaller than and dependent upon the host species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

Very little is known about this species and further study of these bees could help us better understand the ecology and evolution of social and parasitic behaviour.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Risk Statement

As this species only parasitizes its host L. imitatum and does not play a role in the process of pollination, this species has no obvious significant environmental impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Malik, Pankhuri

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!