Overview

Comprehensive Description

Biology

This bee is solitary in some populations, but in others groups of females of apparently equal reproductive status nest together (Wcislo 1997). Its nesting biology is described by Sakagami and Michener (1962): Nest architecture is Type IVb: Lateral burrows are very short or absent such that cells are almost attached to the burrow wall at a right angle. The cells are clustered against one wall and surrounded by a cavity created by burrowing around the entire cell cluster. May have two clusters of cells. Cells are arranged in combs. Nests are known from both flat ground and banks. Nest aggregation information: About 3,500 nests in a single mixed aggregation with H. sexcinctus. Number of cells in the nest: up to 40.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halictus quadricinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTTATCCTCCTCTATCATCAATTATATATCATGCATCTTTCTCTGTTGATTTTTCTATTTTTTCTTTACACATGGCAGGTATTTCATCAATTATAGGTGCTATCAATTTTATTGTAACAATTATTTTAATAAAAAATATTTCTCTAAATTTAAATCAAATACCTCTATTTCCTTGATCAGTAAAAATTACTGCAATTTTACTTCTTTTATCTCTCCCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTTCAGGAGGAGGGGATCCAATTTTATATCAACATCTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATCTTACCTGGATTTGGKTTAATTTCTCATATTATTTTYAAYGAAAGAGGAAAAAAAGAAATTTTTGGAAATTTAGGTATAATTTATGCTATATTAGGTATTGGATTTTTAGGATTTATTGTATGAGCACATCATATATTTACAGTAGGATTAGATGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halictus quadricinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!