Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962): Nest architecture is Type IIIa: Lateral burrows branch off at approximately right angles from the main burrow with a cell at the end of each. Or nest architecture is Type IIIb: Lateral burrows are very short or absent such that cells are almost attached to the burrow walls at a right angle. The cells are not spatially concentrated in any part of the burrow. Flat ground is the only or typical substrate used for nesting.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Halictus parallelus in Illinois

Halictus parallelus Say: Halictidae (Halictinae), Hymenoptera
(observations are from Robertson, Moure & Hurd, Reed, Bernhardt, Smith et al., Tuell et al.)

Anacardiaceae: Rhus copallina [pist sn] (Rb), Rhus glabra [pist sn] (Rb); Apiaceae: Cicuta maculata sn cp (Rb), Eryngium yuccifolium sn (Rb), Heracleum maximum sn cp (Rb), Pastinaca sativa sn (Rb), Perideridia americana sn (Rb), Zizia aurea sn (Rb); Asteraceae: Aster ericoides (Re), Aster novae-angliae sn (Rb), Aster pilosus sn (Rb), Boltonia asterioides sn (Rb), Eupatorium perfoliatum (Tll), Krigia biflora sn (Rb), Rudbeckia subtomentosa sn (Rb), Solidago speciosa (Tll); Caprifoliaceae: Sambucus canadensis cp (Rb), Symphoricarpos orbiculatus sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Fabaceae: Amorpha canescens sn (Rb, Tll), Astragalus canadensis sn (Rb), Dalea candida sn fq (Rb, Smh), Dalea purpurea sn cp fq (Rb, MH, Smh), Melilotus alba sn (Rb), Melilotus officinalis fq (Smh), Trifolium repens sn cp (Rb); Lamiaceae: Blephilia ciliata sn cp (Rb), Lycopus americanus sn (Rb), Nepeta cataria sn (Rb), Pycnanthemum pilosum sn fq (Rb), Pycnanthemum tenuifolium sn fq (Rb), Pycnanthemum virginianum sn (Rb); Mimosaceae: Schrankia nuttallii cp (Bht); Nelumbonaceae: Nelumbo lutea cp fq (Rb); Nymphaeaceae: Nymphaea tuberosa cp dead (Rb); Onagraceae: Ludwigia alternifolia sn cp (Rb), Oenothera pilosella cp np (Rb); Polygonaceae: Persicaria lapathifolia sn cp (Rb), Persicaria pensylvanica sn (Rb); Rhamnaceae: Ceanothus americanus (MH); Rosaceae: Potentilla recta (Re)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halictus parallelus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTTACCCYCCTTTATCTTCAATTACATAYCACCCTTCTTACTCTGTAGATTTTACTATTTTTTCTCTACATATTGCAGGAATTTCTTCAATTATAGGAGCTATTAATTTTATTGTTTCAATTATTTTAATAAAAAATATTTCTCTTAACTTAAATCAAATCCCCTTATTTCCATGATCAGTAAAAATCACCGCAATTTTACTTCTTTTATCCCTTCCAGTTTTAGCAGGAGCTATTACTATACTATTAACAGAYCGAAACTTAAATACATCTTTTTTTGRCCCATCCGGAGGAGGTGACCCTATTCTTTACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATCCTAATCTTACCTGGATTTGGATTAATTTCTCATATCATTTTTAATGAGAGAGGAAAAAAAGAAATTTTTGGAAATTTAGGAATAATTTACGCTATACTAGGAATTGGATTTTTAGGGTTTATTGTATGAGCACATCATATATTTACTGTAGGATTAGATGTAGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halictus parallelus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!