Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962): Nest architecture is Type IIIb: Lateral burrows are very short or absent such that cells are almost attached to the burrow walls at a right angle. The cells are not spatially concentrated in any part of the burrow. Flat ground is the only or typical substrate used for nesting.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Halictus ligatus in Illinois

Halictus ligatus Say: Halictidae (Halictinae), Hymenoptera
(observations are from Robertson, Graenicher, Reed, Moure & Hurd, Petersen, Clinebell & Bernhardt, Clinebell, Bernhardt, Aspinwall & Christian, Estes & Thorp, and Daly)

Acanthaceae: Justicia americana sn (Rb); Alismataceae: Sagittaria latifolia [stam sn] (Rb); Amaryllidaceae: Hypoxis hirsuta cp (Rb); Anacardiaceae: Rhus aromatica [pist sn] (Rb); Apiaceae: Cicuta maculata sn cp (Rb), Cryptotaenia canadensis sn (Rb), Eryngium yuccifolium sn (Rb), Polytaenia nuttalli sn cp (Rb), Sium suave sn (Rb), Taenidia integerrima sn fq (Rb), Zizia aurea sn cp fq (Rb, Re); Asclepiadaceae: Asclepias sullivanti dead np (Rb); Asteraceae: Achillea millefolium sn cp (Rb, Gr, Re), Ageratina altissima sn cp fq (Rb), Antennaria neglecta [stam sn cp] (Gr), Antennaria plantaginifolia [stam sn cp fq] [pist sn fq] (Rb), Anthemis cotula sn cp fq (Rb), Arctium minus sn (Rb), Arnoglossum atriplicifolium cp (Rb), Arnoglossum muhlenbergii sn (Gr), Aster anomalus sn cp (Rb), Aster dumosus (MH), Aster ericoides (Re), Aster lanceolatus sn cp fq (Rb, Gr, Re), Aster novae-angliae sn (Rb), Aster oolentangiensis (Re), Aster pilosus sn cp fq icp (Rb), Aster sagittifolius sn (Rb), Aster salicifolius sn cp (Rb), Bidens aristosa sn cp (Rb), Bidens cernua sn (Rb), Bidens frondosa sn (Rb), Boltonia asterioides sn cp (Rb), Cirsium arvense sn cp (Gr), Cirsium discolor cp np (Rb), Cirsium vulgare cp np (Rb), Conoclinium coelestinum sn cp (Rb), Conyza canadensis (MH), Coreopsis palmata sn cp fq (Rb), Coreopsis tripteris sn cp fq (Rb), Echinacea pallida sn cp (Rb), Echinacea purpurea sn cp fq (Rb, Cl), Erigeron philadelphicus sn cp fq (Rb, Gr, Pt), Erigeron pulchellus sn cp (Rb), Erigeron strigosus sn cp fq (Rb), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn cp fq (Rb), Eupatorium serotinum sn (Rb), Euthamia graminifolia sn cp (Rb), Helenium autumnale sn (Gr), Helianthus annuus sn cp fq (Rb), Helianthus divaricatus sn cp fq (Rb), Helianthus grosseserratus sn cp fq (Rb), Helianthus mollis sn cp fq (Rb), Helianthus pauciflorus sn cp fq (Rb, Re), Helianthus tuberosus sn cp (Rb), Heliopsis helianthoides (Re), Krigia biflora sn cp fq (Rb), Lactuca floridana sn cp (Rb), Leucanthemum vulgare sn cp fq (Rb), Liatris pycnostachya cp np fq (Rb, Cl), Oligoneuron rigidum (Re), Parthenium integrifolium sn (Rb), Pseudognaphalium obtusifolium sn cp fq (Rb), Pyrrhopappus carolinianus cp (MH, ET, Da), Ratibida pinnata sn cp fq (Rb, Gr, Re), Rudbeckia hirta sn cp (Rb, Gr, Re), Rudbeckia laciniata sn cp fq (Rb), Rudbeckia subtomentosa sn cp fq (Rb), Rudbeckia triloba sn cp fq (Rb), Senecio aureus sn cp fq (Rb, Gr), Silphium integrifolium sn (Rb), Silphium laciniatum cp np (Rb), Silphium perfoliatum sn cp (Rb), Silphium terebinthinaceum sn cp fq (Rb), Solidago juncea sn cp (Gr), Solidago missouriensis sn cp fq (Rb), Solidago nemoralis sn (Rb), Solidago canadensis sn cp (Rb, Re), Taraxacum officinale sn cp (Rb), Verbesina helianthoides sn cp (Rb), Vernonia fasciculata cp (Rb); Brassicaceae: Capsella bursa-pastoris sn (Rb), Cardamine bulbosa sn (Rb), Dentaria laciniata sn (Rb), Lepidium virginicum sn (Rb), Rorippa teres sn (Rb); Cactaceae: Opuntia humifusa cp (Mch); Caprifoliaceae: Symphoricarpos orbiculatus sn (Rb); Caryophyllaceae: Stellaria media sn (Rb); Cornaceae: Cornus obliqua sn cp (Rb); Fabaceae: Baptisia australis cp (Pt), Dalea candida sn (Rb), Dalea purpurea sn cp (Rb), Lespedeza virginica sn (Rb), Melilotus alba sn cp (Rb), Melilotus officinalis (Re), Trifolium hybridum sn (Rb), Trifolium repens sn cp (Rb); Lamiaceae: Blephilia ciliata sn (Rb), Hedeoma pulegioides sn (Rb), Lycopus americanus sn (Rb), Monarda fistulosa sn@prf np (Rb, MH), Nepeta cataria sn (Rb), Pycnanthemum pilosum sn fq (Rb), Pycnanthemum tenuifolium sn fq (Rb), Pycnanthemum virginianum sn (Rb), Scutellaria parvula sn (Rb); Liliaceae: Camassia scilloides sn cp (Rb); Lythraceae: Lythrum alatum sn cp (Rb); Malvaceae: Malva neglecta sn (Rb); Mimosaceae: Schrankia nuttallii cp (Bht); Oxalidaceae: Oxalis corniculata sn (Rb), Oxalis violacea sn cp (Rb); Nelumbonaceae: Nelumbo lutea cp (Rb); Onagraceae: Ludwigia alternifolia sn cp (Rb), Oenothera pilosella cp np (Rb); Phytolaccaceae: Phytolacca americana sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Ranunculaceae: Ranunculus fascicularis sn cp (Rb), Ranunculus septentrionalis sn cp (Rb); Rhamnaceae: Ceanothus americanus (MH); Rosaceae: Crataegus intricata sn (Rb), Filipendula rubra cp (AC), Fragaria virginiana sn cp (Rb), Potentilla norvegica sn (Rb), Potentilla recta (Re), Potentilla simplex sn (Rb), Rubus allegheniensis sn cp (Rb), Rubus flagellaris sn (Rb), Rubus occidentalis sn (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb), Houstonia lanceolata sn (Rb); Rutaceae: Ptelea trifoliata sn (Rb); Salicaceae: Salix amygdaloides [stam] [pist sn] (Rb), Salix interior [stam sn cp] (Rb), Salix nigra [stam sn cp] (Rb), Salix rigida [stam sn] (Rb); Scrophulariaceae: Penstemon cobaea cobaea cp (CB), Veronicastrum virginicum sn (Rb, Pt); Valerianaceae: Valerianella radiata sn (Rb); Verbenaceae: Phyla lanceolata sn (Rb), Verbena hastata sn (Rb, Re), Verbena stricta sn (Rb), Verbena urticifolia sn fq (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Halictus ligatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 446
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Halictus ligatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTTTACTTTATTTTTGCTATATGATCAGGAATAATTGGTGCATCACTAAGTATAATTATTCGTATAGAACTAGCAACTCCTGGAAGATGAATTAATAATGATCAAATTTATAATACTATTGTTACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCATTCATAATTGGAGGGTTTGGAAATTGATTAGTACCCTTAATAATTGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTAATTCCTTCCTTATTACTACTATTAATAGGAAATACTTTAACTTCAGGTTCAGGAACAGGATGAACAATTTATCCTCCATTATCATCAATTATATTTCATTCATCTTTTTCAGTAGATTTTTCTATCTTCTCCTTACATATAGCAGGAATTTCTTCAATCATAGGAGCTATTAATTTTATTGTAACTATTATTTTAATAAAAAATATTTCACTTAATATAAATCAAATCCCTCTATTTCCTTGATCAGTAAAAATTACTGCAATTCTACTTCTTCTCTCTCTTCCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTTCAGGAGGTGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!