Overview

Distribution

Range Description

Halictus crenicornis is distributed in the north-western part of the Mediterranean basin (Blüthgen 1923, 1924). The extent of occurrence (EOO) is 605,952 km² and the area of occupancy (AOO) is 296 km².
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat of this species is unknown.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halictus crenicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTTATCCACCACTATCATCAATTACATATCATTCATCTTTCTCTGTAGATTTTACTATTTTTTCTTTACATATTGCAGGAATTTCTTCAATTATAGGAGCTATCAATTTTATCGTCTCAATTATCTTAATAAAAAATATTTCACTTAATTTAAACCAAATTCCTTTATTTCCTTGATCAGTTAAAATTACTGCAATTTTATTACTTTTATCTCTACCCGTTTTAGCAGGAGCTATCACTATATTATTAACTGATCGGAACTTAAATACTTCTTTTTTTGATCCATCAGGAGGAGGTGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTACCAGGATTCGGATTAATTTCTCATATTATTTTCAATGAAAGAGGAAAAAAAGAAATTTTTGGAAACCTAGGAATAATTTATGCAATATTAGGAATTGGATTTTTAGGTTTTATTGTATGAGCTCATCACATATTCACAGTTGGTTTAGATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halictus crenicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Michez, D., Nieto, A. & Pauly, A.

Reviewer/s
Bilz, M. & Roberts, S.

Contributor/s

Justification
Listed as Data Deficient in view of the absence of information on population size and trend, ecological requirements, threats and conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is rare and the current population trend is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no direct conservation measures in place for this species. It possibly occurs within protected areas. Additional studies are needed into the abundance, general ecology and threats of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!