Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962): Nest architecture is Type IIIb: Lateral burrows are very short or absent such that cells are almost attached to the burrow walls at a right angle. The cells are not spatially concentrated in any part of the burrow. Flat ground is the only or typical substrate used for nesting.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Halictus confusus in Illinois

Halictus confusus Smith: Halictidae (Halictinae), Hymenoptera
(observations are from Robertson, Graenicher, Moure & Hurd, Reed, Evans, Petersen, Catling & Knerer, Godfery, Schemske et al., and Barrett & Helenurm)

Acanthaceae: Justicia americana sn (Rb); Anacardiaceae: Rhus copallina [pist sn fq] (Rb), Rhus glabra [pist sn] (Rb); Apiaceae: Cicuta maculata sn (Rb), Cryptotaenia canadensis sn fq (Rb), Erigenia bulbosa sn (Rb, Gr), Eryngium yuccifolium sn (Rb), Heracleum maximum sn (Rb), Osmorhiza longistylis sn (Rb), Pastinaca sativa sn (Rb), Polytaenia nuttalli sn cp (Rb), Sium suave sn (Rb), Taenidia integerrima sn fq (Rb), Zizia aurea sn cp fq (Rb, Re); Apocynaceae: Apocynum cannabinum [plab sn] (Rb, MH); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias sullivanti dead np (Rb), Asclepias syriaca [plpr sn] (Rb), Asclepias tuberosa [plup sn] (Ev), Asclepias verticillata [plpr sn] (Rb); Asteraceae: Achillea millefolium (Re), Ageratina altissima sn cp (Rb, Gr), Antennaria neglecta [stam sn cp] (Ev, Gr), Antennaria plantaginifolia [stam sn cp fq] [pist sn fq] (Rb), Anthemis cotula sn cp (Rb, Gr), Arctium lappa sn cp (Gr), Arnoglossum muhlenbergii sn cp (Gr), Aster drummondii sn (Gr), Aster furcatus sn cp (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb, Gr), Aster lateriflorus sn cp (Gr), Aster macrophyllus sn cp (Gr), Aster oolentangiensis (Re), Aster pilosus sn (Rb), Aster prenanthoides sn cp (Gr), Aster puniceus sn cp (Gr), Boltonia asterioides sn (Rb), Cirsium arvense sn (Gr), Cirsium discolor cp np (MH), Coreopsis palmata sn cp fq (Rb), Erigeron philadelphicus sn cp fq (Rb), Erigeron strigosus sn cp fq (Rb), Eupatoriadelphus purpureus sn cp (Gr), Eupatorium altissimum sn (Rb), Eupatorium perfoliatum sn (Gr), Euthamia graminifolia sn cp (Gr), Helenium autumnale sn cp (Rb, Gr), Helianthus annuus sn (Rb), Helianthus tuberosus (Re), Heliopsis helianthoides (Re), Krigia biflora sn cp fq (Rb), Leucanthemum vulgare sn cp (Gr), Parthenium integrifolium sn cp (Rb), Pseudognaphalium obtusifolium sn (Rb), Ratibida pinnata sn cp (Gr, Re), Rudbeckia hirta sn cp (Gr), Rudbeckia laciniata sn (Gr), Rudbeckia subtomentosa sn cp fq (Rb), Rudbeckia triloba sn (Rb), Senecio aureus sn cp (Gr), Solidago canadensis sn cp (Rb, Gr), Solidago juncea sn cp (Gr, Ev), Solidago missouriense sn (Rb); Berberidaceae: Jeffersonia diphylla cp (Gr); Boraginaceae: Hackelia virginiana sn (Rb); Brassicaceae: Arabis shortii sn cp (Rb), Capsella bursa-pastoris sn cp (Rb), Cardamine bulbosa sn fq (Rb), Dentaria laciniata (Shm), Descurainia pinnata sn cp (Rb), Lepidium virginicum sn (Rb), Rorippa teres sn fq (Rb), Sibara virginica sn (Rb); Campanulaceae: Lobelia spicata sn (Rb), Triodanis perfoliata sn (Rb); Caprifoliaceae: Symphoricarpos occidentalis (MH), Symphoricarpos orbiculatus sn (Rb); Caryophyllaceae: Cerastium fontanum sn (Rb), Cerastium nutans sn cp fq (Rb), Stellaria longifolia sn (Rb), Stellaria media sn (Rb); Commelinaceae: Tradescantia ohiensis cp (Rb), Tradescantia virginiensis cp (MH); Cornaceae: Cornus canadensis (BH), Cornus florida sn cp fq (Rb); Euphorbiaceae: Euphorbia corollata sn (Rb); Fabaceae: Amorpha canescens sn (Rb, Re), Cercis canadensis sn cp fq (Rb), Dalea candida sn fq (Rb), Dalea purpurea sn cp fq (Rb, Re), Desmodium canadense cp (Re), Melilotus alba sn (Rb), Melilotus officinalis (Re), Orbexilum onobrychis sn icp (Rb), Trifolium hybridum sn cp (Rb), Trifolium repens sn cp fq (Rb), Vicia americana (Re); Grossulariaceae: Ribes missouriense sn (Gr); Hydrangeaceae: Hydrangea arborescens cp (Rb); Hydrophyllaceae: Ellisia nyctelea sn cp (Rb); Iridaceae: Sisyrinchium angustifolium sn cp fq (Rb); Lamiaceae: Blephilia ciliata sn cp (Rb), Leonurus cardiaca cp np (Rb), Lycopus americanus sn (Rb), Monarda fistulosa sn@prf cp np (Rb, Ev, Pt, MH, Re), Nepeta cataria sn (Rb), Prunella vulgaris sn (Rb), Pycnanthemum pilosum sn fq (Rb), Pycnanthemum tenuifolium sn (Rb), Pycnanthemum virginianum sn fq (Rb, Re); Liliaceae: Allium canadense sn (Gr), Allium tricoccum sn cp (Gr), Camassia scilloides sn cp fq (Rb), Erythronium albidum sn (Rb), Maianthemum canadense cp (Gr), Smilacina stellata sn cp (Gr), Uvularia grandiflora sn (Gr); Lythraceae: Lythrum alatum sn (Rb); Malvaceae: Abutilon theophrastii sn (Rb), Malva neglecta sn cp fq (Rb); Molluginaceae: Mollugo verticillata sn (Rb); Onagraceae: Ludwigia alternifolia sn (Rb), Oenothera pilosella cp np (Rb); Orchidaceae: Cypripedium candidum (CK), Spiranthes romanzoffiana sn (Gd); Oxalidaceae: Oxalis corniculata sn (Rb), Oxalis violacea sn cp fq (Rb); Papaveraceae: Sanguinaria canadensis cp (Gr); Phytolaccaceae: Phytolacca americana sn (Rb); Polygonaceae: Persicaria hydropiperoides sn (Rb), Persicaria pensylvanica (MH); Ranunculaceae: Anemonella thalictroides sn fp fq (Rb), Enemion biternatum cp fq (Rb), Ranunculus abortivus sn (Rb), Ranunculus fascicularis sn (Rb), Ranunculus septentrionalis sn cp (Rb); Rhamnaceae: Ceanothus americanus sn cp (Rb), Rhamnus lanceolata sn cp fq (Rb); Rosaceae: Amelanchier arborea sn cp (Rb), Crataegus crus-galli sn cp fq (Rb), Crataegus intricata sn fq (Rb), Crataegus mollis sn cp fq (Rb), Fragaria virginiana sn cp fq (Rb, Ev), Geum canadense sn (Rb), Geum vernum sn (Rb), Potentilla arguta (Re), Potentilla norvegica sn fq (Rb), Potentilla recta (Re), Potentilla simplex sn (Rb), Prunus americana sn cp (Rb), Prunus serotina [flwr sn cp] (Rb), Rosa blanda cp (Re), Rubus allegheniensis sn cp fq (Rb), Rubus flagellaris (Ev), Rubus occidentalis sn (Rb, Re); Rubiaceae: Houstonia lanceolata sn (Rb), Houstonia longifolia (Ev); Salicaceae: Salix amygdaloides [stam sn cp fq] [pist sn fq] (Rb), Salix discolor [unsp sn] (Gr), Salix humilis [pist sn] (Rb), Salix interior [stam sn cp] (Rb), Salix nigra [stam sn cp] (Rb), Salix rigida [stam sn fq] [pist sn fq] (Rb); Saxifragaceae: Heuchera richardsonii sn cp (MH, Gr); Scrophulariaceae: Linaria vulgaris (Arn), Scrophularia marilandica sn cp (Rb), Veronica peregrina sn fq (Rb), Veronicastrum virginicum sn (Rb, Pt); Smilacaceae: Smilax herbacea sn cp (Gr); Staphyleaceae: Staphylea trifolia sn (Rb); Verbenaceae: Phyla lanceolata sn (Rb), Verbena hastata sn fq (Rb, Re), Verbena urticifolia sn fq (Rb); Violaceae: Viola cucullata sn np (Rb), Viola pubescens sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Halictus confusus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 235
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Halictus confusus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTTTATTTTATTTTCGCTATATGATCAGGAATAATTGGGGCCTCATTAAGAATAATTATTCGTATAGAATTAAGAACTCCTGGAAGATGAATTAATAATGACCAAATCTATAACACTATTATCACATCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCATTTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGGGCCCCTGATATGGCATTTCCACGAATAAATAATATAAGATTTTGATTACTTATTCCTTCTTTATTCATACTTTTAATAAGAAGAACTATATCAACGGGATCGGGGACAGGATGGACTATTTACCCCCCATTATCATCAATTATATATCATTCAACTTCTTCCGTAGATTTTACTATTTTTTCACTCCATATGGCAGGAATTTCTTCAATTATGGGAGCTATTAATTTTATTGTTTCAATTATATTAATAAAAAATATCTCACTTAAAATAAATCAAATCCCTTTATTCCCATGATCAGTAAAAATCACTGCTATTTTACTACTCTTATCCTTACCTATTTTAGCTGGGGCAATTACTATATTACTTACTGATCGAAACATAAATACATCTTTCTTTGACCCCTCCGGAGGAGGAGATCCAATTCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!