Overview

Comprehensive Description

Biology

This bee's nest architecture is described by Sakagami and Michener (1962). From Sakagami and Michener (1962): Nest architecture is Type VIIa: The main burrow expands into a cavity enclosing a cluster of horizontally oriented cells. Below the cells is an extension of the main burrow. Cells are arranged in combs. Flat ground is the only or typical substrate used for nesting.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smith, Adam

Source: Halictidae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Augochlorella aurata in Illinois

Augochlorella aurata Smith: Halictidae (Halictinae), Hymenoptera
(Observations are from Robertson, Moure & Hurd, Ne'eman et al., McCall & Primack, Steury et al., Smith et al., Grundel et al., Tuell et al.)

Acanthaceae: Justicia americana sn (Rb); Alismataceae: Alisma plantago-aquatica sn fq (Rb), Sagittaria graminea (Gnd); Amaryllidaceae: Hypoxis hirsuta cp fq (Rb); Anacardiaceae: Rhus copallina [pist sn] [unsp] (Rb, Gnd), Rhus glabra [pist sn] (Rb); Apiaceae: Polytaenia nuttalli sn cp (Rb), Taenidia integerrima sn cp fq (Rb), Thaspium trifoliatum flavum sn cp (Rb), Zizia aurea sn cp fq (Rb, Tl); Apocynaceae: Apocynum androsaemifolium [plab sn] [plup sn] (Rb, Gnd), Apocynum cannabinum [plup sn] (Gnd); Asclepiadaceae: Asclepias incarnata [plpr sn] (Rb), Asclepias purpurascens [plab sn] (Rb), Asclepias tuberosa [plup sn fq] (Gnd), Asclepias verticillata [plup sn] (Gnd); Asteraceae: Antennaria plantaginifolia [stam sn cp fq] [pist sn fq] (Rb), Anthemis cotula sn cp (Rb), Aster spp. (Gnd), Aster dumosus (Gnd), Aster ericoides (Gnd), Aster lanceolatus sn (Rb), Aster lateriflorus sn (Rb), Aster oolentangiensis (Gnd), Aster pilosus sn fq (Rb), Conoclinium coelestinum sn cp (Rb), Coreopsis lanceolata (Gnd), Coreopsis palmata sn cp (Rb), Coreopsis tripteris fq (Gnd), Doellingeria umbellata (Gnd), Echinacea pallida sn (Rb), Erigeron annuus (SDO), Erigeron philadelphicus sn cp (Rb), Erigeron strigosus sn cp (Rb, Gnd), Eupatorium altissimum sn (Rb, Gnd), Eupatorium hyssopifolium (SDO), Eupatorium perfoliatum sn (Rb, Gnd, Tll), Helenium amarum fq (Smh), Helianthus divaricatus fq (Gnd), Helianthus mollis sn cp (Rb), Helianthus occidentalis (Gnd), Hieracium caespitosum (Gnd), Hieracium gronovii (Gnd), Hieracium umbellatum (Gnd), Ionactis linariifolius (Gnd), Krigia biflora sn cp fq (Rb, Gnd), Krigia virginica (Gnd), Leucanthemum vulgare sn cp fq (Rb, Gnd), Liatris aspera (Gnd), Liatris cylindracea (Gnd), Parthenium integrifolium sn cp fq (Rb), Pseudognaphalium obtusifolium sn (Rb), Ratibida pinnata (Smh, Tll), Rudbeckia hirta fq (Smh, Gnd), Rudbeckia triloba sn cp (Rb), Senecio anonymus (Smh), Senecio aureus sn (Rb), Silphium laciniatum (Smh), Solidago spp. fq (Smh, Gnd), Solidago caesia (Gnd), Solidago juncea (Gnd), Solidago missouriensis sn (Rb), Solidago nemoralis sn (Rb), Solidago riddellii (Tll), Solidago simplex racemosa (SDO), Solidago speciosa (Gnd), Verbesina helianthoides sn cp (Rb), Vernonia gigantea (Gnd); Bignoniaceae: Campsis radicans np (Smh); Brassicaceae: Arabis lyrata (Gnd), Arabis shortii sn cp (Rb), Capsella bursa-pastoris sn cp fq (Rb), Cardamine bulbosa sn (Rb), Descurainia pinnata sn cp fq (Rb), Lepidium virginicum sn cp fq (Rb), Rorippa teres sn fq (Rb), Sibara virginica sn (Rb); Cactaceae: Opuntia humifusa (Gnd); Caesalpiniaceae: Chamaecrista fasciculata [exfl sn] [unsp] (Rb, Smh), Chamaecrista nictitans [unsp] (Gnd); Campanulaceae: Lobelia siphilitica np (Tll), Lobelia spicata (Gnd), Triodanis perfoliata sn cp fq (Rb); Caprifoliaceae: Symphoricarpos orbiculatus sn fq (Rb); Caryophyllaceae: Cerastium fontanum sn (Rb), Stellaria longifolia sn (Rb), Stellaria media sn (Rb); Cistaceae: Helianthemum canadense cp (Gnd); Commelinaceae: Tradescantia ohiensis cp (Rb, Gnd), Tradescantia virginiensis cp (MH); Cornaceae: Cornus obliqua sn cp (Rb), Cornus racemosa sn (Rb); Ebenaceae: Diospyros virginiana [stam cp np] (Rb); Ericaceae: Gaylussacia baccata (Gnd); Euphorbiaceae: Euphorbia corollata (SDO, Gnd); Fabaceae: Amorpha canescens sn cp (Rb), Dalea candida sn fq (Rb), Dalea purpurea sn cp fq (Rb, Smh), Lespedeza virginica sn (Rb), Lupinus perennis (Gnd), Melilotus alba sn (Rb), Melilotus officinalis (Smh), Tephrosia virginiana (Gnd), Trifolium hybridum sn cp (Rb, Gnd), Trifolium repens sn (Rb); Gentianaceae: Sabatia angularis cp np (Rb); Geraniaceae: Geranium maculatum sn np (Rb); Hypericaceae: Hypericum kalmianum cp (Gnd); Iridaceae: Sisyrinchium angustifolium sn cp (Rb); Lamiaceae: Blephilia ciliata sn cp fq (Rb), Hedeoma pulegioides sn cp fq (Rb), Lycopus americanus sn (Rb), Monarda bradburiana sn@prf np (Rb), Monarda fistulosa np (Gnd), Monarda punctata np (Gnd), Pycnanthemum tenuifolium sn fq (Rb); Liliaceae: Allium cernuum (SDO), Asparagus officinalis cp (Rb), Camassia scilloides sn (Rb), Nothoscordum bivalve sn fq (Rb, Smh), Smilacina stellata sn cp (Rb, Gnd); Lythraceae: Ammannia coccinea sn cp (Rb), Cuphea viscosissima sn cp np (Rb), Lythrum alatum (Smh); Malvaceae: Malva neglecta sn fq (Rb); Mimosaceae: Desmanthus illinoensis fq (Smh); Onagraceae: Gaura biennis (Smh), Ludwigia alternifolia sn cp (Rb), Ludwigia polycarpa sn (Rb), Oenothera biennis (Gnd), Oenothera fruticosa (Gnd); Plantaginaceae: Plantago major cp (Rb); Polemoniaceae: Phlox pilosa (Gnd), Polemonium reptans sn (Rb); Portulacaceae: Claytonia virginica sn (Rb); Primulaceae: Lysimachia quadrifolia cp (MP); Ranunculaceae: Aquilegia canadensis np (Gnd), Ranunculus abortivus sn (Rb), Ranunculus recurvatus sn (Rb); Rhamnaceae: Ceanothus americanus (Gnd); Rosaceae: Crataegus crus-galli sn cp fq (Rb), Fragaria virginiana sn cp fq (Rb, Gnd), Geum canadense sn cp (Rb), Geum vernum sn cp fq (Rb), Potentilla norvegica sn cp (Rb), Potentilla simplex sn cp fq (Rb), Prunus serotina [flwr sn cp fq] (Rb), Rosa carolina cp (Gnd), Rubus allegheniensis sn cp (Rb), Rubus flagellaris sn cp (Rb), Rubus hispidus (Gnd); Rubiaceae: Hedyotis nigricans (Smh), Houstonia lanceolata sn cp (Rb); Salicaceae: Salix interior [stam sn cp] (Rb), Salix nigra [stam sn] (Rb), Salix rigida [stam sn] (Rb); Sarraceniaceae: Sarracenia purpurea sn cp (NNE); Saxifragaceae: Heuchera americana (Tll), Heuchera richardsonii sn cp fq (Rb); Scrophulariaceae: Aureolaria pedicularia fq (Gnd), Veronica arvensis sn (Rb), Veronica peregrina sn fq (Rb); Smilacaceae: Smilax herbacea [stam sn cp] (Rb); Valerianaceae: Valerianella radiata sn fq (Rb); Verbenaceae: Phyla lanceolata sn cp fq (Rb), Verbena simplex sn (Rb), Verbena stricta sn (Rb), Verbena urticifolia sn fq (Rb); Vitaceae: Ampelopsis arborea (Smh)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Augochlorella aurata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTATATTTTATTTTTGTTATATGATCTGCTTCCGTAGGAGCATCCTTAAGTATAATTATTCGTATAGAATTAAGTGTACCAGGAGGATGAATTAATAACGATCAAATTTATAATACAATTGTAACTTCTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTCATAATTGGAGGATTTGGAAATTGGCTTGCCCCTCTAATAGTTGGAACCCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGACTTTTAATTCCATCACTATTTTTATTATTATTAAGAAATATTTTTAATTCAGGATCAGGAACTGGATGAACAATTTATCCTCCCCTATCATCAATTGAATACCATCCTTCATCCTCAGTTGATTTTACAATCTTTTCTCTTCATATTGCTGGTATCTCTTCAATTATAGGTGCAATTAATTTTATTGCCTCCATTTTAATAATAAAAAATATATCATTAAATTATGATCAAGTACCTTTATTCCCATGATCAGTAAAAATTACAGCTATTTTATTACTTCTCTCATTACCTGTACTTGCTGGAGCCATTACTATATTATTAACAGATCGAAACTTAAATTCATCCTTTTTTGATCCATCAGGTGGAGGAGATCCTGTTCTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Augochlorella aurata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!