Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Alsophila aescularia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alsophila aescularia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCCGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTACCTCTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTCTCACTCTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTATATCCTCCTTTATCTTCTAATATTGCTCACGGAGGAAGAGCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGACCAAATACCATTATTTATTTGATCTGTTGGAATTACAGCTTTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAACACATCATTTTTCGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alsophila aescularia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alsophila aescularia

The March Moth (Alsophila aescularia) is a moth of the family Geometridae. It is found throughout Europe and is a pest of fruit trees.

Female laying eggs
Caterpillar

The female of this species is wingless. It is usually found resting on tree-trunks. The male has a distinctive way of resting with overlapping wings.The wings appear long and narrow in this position. The males are attracted to light.

The wingspan is 25–35 mm. The colour of the forewings varies between pale brownish and grayish brown. There is a well-defined Usually dark brown central band. The lines are sharply toothed and on the opposite side to the band they are whitish. A prominent black dot is present on the hind wings. Darkened specimens are rare. In these the lines are extinguished or the butterfly is completely black

The females have no wings. They are eight to ten millimeters long. The abdomen is brownish grey, the abdominal hair tuft is about two millimeters wide and thus narrower than the abdomen, which represents a differentiator against Alsophila aceraria.

The palps are very short, the sensors are slightly toothed. The proboscis is stunted. The tibiae of the hind legs have four spurs that are very short in females.

The bright pale-green larva reaches a length of about 26 millimeters. It is characterized by a very smooth skin and a flat head. There is a dark green dorsal line and yellowish-white lateral lines. In contrast to other geometrid caterpillars, they have an additional rudimentary abdominal leg pair in the fifth segment.

The adults are active in March and April [1].

The larva feeds on a range of trees. Malus domestica, Prunus domestica, Prunus domestica domestica,Prunus spinosa, Prunus padus, Cerasus, Tilia, Quercus robur, Quercus petraea, Quercus rubra,Acer campestris, Acer pseudoplatanus, Ulmus, Crataegus, Rosa canina, Ligustrum vulgare, Carpinus betulus, Fagus sylvatica Corylus arvellana, Fraxinus excelsior, Lonicera xylosteum, Rhamnus cathartica,Betula pendula.

Long, spider's-web like strings hang from oak trees in the southern hemisphere.The larvae hangs from one end.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!