Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Pales pavida is endoparasitoid of larva of Alsophila aescularia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alsophila aescularia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCCGAATTAGGAAACCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTACCTCTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTCTCACTCTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTATATCCTCCTTTATCTTCTAATATTGCTCACGGAGGAAGAGCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGACCAAATACCATTATTTATTTGATCTGTTGGAATTACAGCTTTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAACACATCATTTTTCGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alsophila aescularia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alsophila aescularia

The March Moth (Alsophila aescularia) is a moth of the family Geometridae. It is found throughout Europe.

Female laying eggs
Caterpillar

The female of this species is wingless. It is usually found resting on tree-trunks. The male has a distinctive way of resting with overlapping wings. The males are attracted to light.

The wingspan is 25–35 mm. The adults are active in March and April [1].

The larva is pale-green and feeds on a range of trees. Long, spider's-web like strings hang from oak trees in the southern hemisphere. The worm like larvae hangs from one end.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!