Molecular Biology and Genetics
Molecular Biology
Barcode data: Lycaeides argyrognomon
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATATTATTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTACCCACCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCACTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTCGGAATTACTGCATTACTATTACTTTTATCTCTACCAGTATTAGCCGGAGCAATTACTATATTATTAACTGATCGAAATCTTAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTCTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTACCGGGATTTGGTATTATTTCACATATTATTTCTAATGAAAGAGGAAAAAAAGAAACTTTTGGATCTTTAGGTATAATTTATGCAATACTAGCTATTGGTTTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACTCGAG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Lycaeides argyrognomon
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Plebejus argyrognomon
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 23 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 23 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGAATCTTAATTCGTATAGAATTAGGAACTCCTGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGGGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATATTATTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTTTACCCACCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCACTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTCGGAATTACTGCATTACTATTACTTTTATCTCTACCAGTATTAGCCGGAGCAATTACTATATTATTAACTGATCGAAATCTTAATACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Plebejus argyrognomon
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 31
Species With Barcodes: 1
Public Records: 27
Specimens with Barcodes: 31
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Plebejus argyrognomon
The Reverdin's Blue (Plebejus argyrognomon) is a butterfly of the Lycaenidae family. It is found in Europe.
The wingspan is 25–30 mm. The butterfly flies from May to August depending on the location.
The larvae feed on Securigera varia and Astragalus glycyphyllos.
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
