Overview

Comprehensive Description

Description

Size: 24-26 mm. The underside of the wings are pale brown with wavy white lines but no broad white band. The upperside of the wing of the male is violet-blue, while in female is grey-brown with blue markings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Records

89 records. Latest in 2006 (many locations)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Northern and eastern Egypt. AOO = 198 km2. EOO = 487,000 km2. More than 10 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (Africa and Arabia)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cultivated and desert areas near legumes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Host-plants: many Leguminosae, plus others such as Plumbago (Plumbaginaceae).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

The Flight Period

May-November

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Several generations per year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Leptotes pirithous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Leptotes pirithous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTTTTTCACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAAGAGGAATATTAGGAACTTCATTAAGAATTTTAATTCGAATAGAATTAGGAACACCAGGATCTTTTATTGGTGAT---GATCAAATTTATAATACAATCGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCTTTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAACATAAGATTTTGATTATTACCTCCATCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTATCCCCCACTATCATCTAATATTGCTCATGGAGGATCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATTTATCTTTTGACCAAATATCTTTATTTATTTGAGCCGTTGGAATTACAGCATTATTACTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCTGCCGGAGGAGGAGATCCAATTTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Resident and migrant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Abundant

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Can be a pest of legume crops such as peas and beans since crop unmarketable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leptotes pirithous

Leptotes pirithous is a butterfly of the family Lycaenidae. Its common names are Lang's Short-tailed Blue and Common Zebra Blue

Description[edit]

Leptotes pirithous is a small butterfly with a wingspan of 21–29 mm in males and 24–30 mm in females. The uppersides of the wings are purple bluish in males, bluish-brown in female. The undersides are dark beige striped with white lines. The hindwings show marginal orange and black spots and two small tails. For the design of the undersides of the wings they can be confused with Lampides boeticus and Cacyreus marshalli. These butterflies fly from February to November depending on the location. They are regular migrants.

The larvae feed on the flowers and fruits of Fabaceae, Rosaceae and Plumbaginaceae species, including Plumbago capensis, Indigofera, Rynchosia, Vigna, Burkea, Mundulea, Melilotus, Crataegus, Quercus suber, Medicago sativa, Trifolium alexandrium, Arachis hypogaea, Lythrum, Calluna, Genista, Dorycnium, Lythrum salicaria, Calluna vulgaris, Onobrychis viciifolia, Ulex and Melilotus alba. A life cycle takes about 4–8 weeks, depending on the temperature.

Distribution[edit]

This species can be found in southern Europe (Spain, France and Italy), along the Mediterranean coast, in Asia Minor up to the Himalayas, and in most of Africa and Madagascar.

Subspecies[edit]

Habitat[edit]

This species prefers varied wasteland, cultivated areas and gardens.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!