Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Silver-studded blues live in the dune heath fields of Terschelling, Texel and Schiermonnikoog. The wings of the male are blue from above while those of the female are brown. The silver-studded blue lays its eggs on heather and cross-leaved heath. It lives in transition zones between wet and dry terrains. The caterpillars pupate in ant nests. Silver-studded blues are on the Red List for threatened butterfly species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The adult flight period occurs between July and August on heathland and between June and mid-July on calcareous grasslands. There is a single brood a year; eggs are laid singly near the ground where they overwinter. The following spring the larvae hatch, soon after hatching they are closely tended by ants of the genus Lasius which are attracted by sugar-rich secretions produced by the caterpillar, and provide protection against predators. Pupation usually occurs in or near to ant nests, and the pupa continues to be protected by ants (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Males are deep blue with a dark border and white fringe, and can be distinguished from other blue butterflies by the presence of a spur on the front legs (1). Females are brown, but both sexes possess metallic silver spots on the hindwings (3). The caterpillar grows to 1.3 centimetres in length, and is green in colour with a dark stripe along the back, and white stripes along the sides (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The silver-studded blue is widespread in temperate areas of Europe and Asia (3), but underwent a severe decline in Great Britain during the twentieth century (4). It has become extinct in most northern and central areas, parts of Wales and the North Downs. It is now largely restricted to heathland in Dorset and Hampshire (4), with a few populations in Wales, Suffolk, Norfolk Cornwall and Shropshire (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found in lowland heathland, chalk grasslands, and some sand dunes. In all three habitats, the species needs short vegetation and ants of the genus Lasius (4). A supply of the main larval foodplants is also essential. These include a wide range of plants, the more common being heather, bell heather, cross-leaved heath and gorses on heathland, as well as common bird's foot trefoil, common rock-rose and horseshoe vetch on calcareous sites (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Plebejus argus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Plebejus argus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACTCCTGGATCTTTGATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATATTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTCTACCCCCCACTTTCATCTAATATTGCACACAGAGGATCATCTGTAGATTTAGCAATTTTCTCACTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTCGGAATTACTGCATTATTATTACTTTTATCCCTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATCTTAATACTTCATTTTTTGACCCAGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Protected by Schedule 5 of the Wildlife and Countryside Act, 1981, with respect to sale only (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

A number of factors contributed to the decline of this species, including widespread loss and fragmentation of heathland due to agricultural intensification, forestry and development. There has been a 60 percent loss of heathland in Britain, and remaining fragments have often become degraded due to a decline in traditional management techniques. The introduction of myxomatosis during the 1950s resulted in a huge decline in rabbit grazing and a loss of short vegetation. Chalk grassland habitats greatly declined as a result (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The remaining heathlands in Britain are the focus of huge conservation effort. A number of key silver-studded blue populations occur in nature reserves, Sites of Special Scientific Interest (SSSIs) and candidate Special Areas of Conservation. There have been a number of re-introductions of this species, and English Nature has produced a booklet on its conservation in lowland heathland (4). The silver-studded blue is a priority species under the UK Biodiversity Action Plan (UK BAP) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silver-studded Blue

The Silver-studded Blue (Plebejus argus) is a butterfly in the family Lycaenidae. It occurs throughout the Palearctic ecozone.

Subspecies[edit]

  • P. a. argus Scandinavia
  • P. a. aegon (Denis & Schiffermüller, 1775) Karelia
  • P. a. cleomenes (Fruhstorfer, 1910) Carpathians
  • P. a. wolgensis (Forster, 1936) S.Europe, Kazakhstan, Tian-Shan, Tarbagatai, Saur, S.Altai
  • P. a. bellus (Herrich-Schäffer, [1844]) Asia Minor, Kurdistan, Levant, Caucasus, Armenia, Talysh
  • P. a. obensis (Forster, 1936) Ural, W.Siberia
  • P. a. clarasiaticus (Verity, 1931) E. Altai, Sayan, Transbbaikalia, W.Amur
  • P. a. pamirus (Forster, 1936) Pamirs-Alai, Tian-Shan
  • P. a. coreanus Tutt, 1909 E.Amur, Ussuri, Korea
  • P. a. micrargus (Butler, 1878) Japan, Sakhalin
  • P. a. asur Agenjo, 1966 Villasur, Spain
  • P. a. bejarensis (Chapman, 1902) Castilla-Leon, Béjar, Spain
  • P. a. branuelasensis (Tutt, 1909) Branuelas, Spain
  • P. a. casaiacus Chapman, 1907Casayo, N.W. Spain
  • P. a. claraobscura (Verity, 1931) Larche, Basses-Alpes, 1700-2000m, France
  • P. a. seoki Shirozu & Sibitani, 1943 Saishuto, Korea
  • P. a. vigensis Tutt, 1909 Vigo, NW.Spain
  • P. a. sultana (Forster, 1936) Asia Minor

Appearance, behavior and distribution[edit]

So named due to the silvery blue metallic spots on the underside hind wings. The upperside are a rich, deep iridescent blue in the males with a black border and the characteristic Lycid white fringe. on the hindwings there is a row of inconspicuous black spots along the bottom edge. Females are dark brown with orange spots at the edges. On some sites the female has blue colouration but never as extensive as the male and she always possesses the orange spots. The undersides are a typical "Blue" design. The ground colour is silvery grey with blue suffusion at the base of the wings in the male and brown in the female. There are a number of black spots, each outlined in white and a row of orange spots along the outer edge of the hindwings, extending onto the forwings in the female. It is next to these orange spots that the "silver-studs" can be seen. Most easily confused with the Common Blue, it is generally slightly smaller and in the male the blue is a darker shade. The Common Blue also has an additional black spot at the base of the underside forewing.

It has suffered severe reduction in its range in the UK due to habitat destruction. Its favoured habitat is heathland and where it is found in the southern strongholds it can still be very numerous. Other habitats include calcerous grassland and dunes. Apart from its strongholds in the southern heathlands it is also found in scattered colonies in Norfolk, Suffolk, Devon, Cornwall and Wales. It is still widespread and locally common across Europe, Asia as far as Japan.

Museum specimens

Lifecycle and foodplants[edit]

Eggs are laid on or near the ground, often near Ants nests and pass through the winter hatching in the spring in late March or early April. They have a wide variety of foodplants; on heathland the favourites include Heather Calluna vulgaris, Bell Heather Erica cinerea, Cross-leaved Heath Erica tetralix and Gorses Ulex spp. On grasslands Bird's-foot Trefoil Lotus corniculatus, Common Rock-rose Helianthemum nummularium, Horseshoe Vetch Hippocrepis comosa and Wild Thyme Thymus serpyllum are used. The larvae have a close relationship with ants and produce a honeydew-like liquid to feed them. In return the ants will protect the larvae from predators. Black ants Lasius niger and Lasius alienus are the two most commonly associated ant species. In some European countries ants have been seen carrying the larvae. Pupation takes near and often inside ant nests where they continue to secrete Honey Dew until the Butterfly emerges. It is single brooded with butterflies on the wing from July until mid August.

Gallery[edit]

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!