Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pseudophilotes vicrama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pseudophilotes vicrama

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGAAAATGACTTTTTTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGTATAGAATTAGGAACACCTGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCACCTGATATAGCATTTCCACGAATAAATAACATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCCCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTAAATAATTTATCATTTGATCAAATATCATTATTTATTTGAGCAGTAGGTATTACAGCATTATTATTATTACTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATCTTAATACCTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTCTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudophilotes vicrama

The Eastern Baton Blue (Pseudophilotes vicrama)[1] is a small butterfly found from Asia,[2][3] east to Tian Shan and parts of China, west to the Balkan, Turkey, eastern Europe to southern Finland. It belongs to the Lycaenids or Blues family.

Taxonomy[edit]

The butterfly was earlier known as Polyommatus vicrama (Staudinger).[2]

Range[edit]

In Asia, it is found in South Asia from India (Himachal Pradesh) westwards to Balochistan and Chitral in Pakistan.[2]

Underside

Wynter-Blyth records the Eastern Baton Blue as Not Rare locally and occurring in Baluchistan and from Chitral to Shipki La.[4]

As per Savela, the butterfly is found in the Pamirs - Alay Mountains, Ghissar - Darvaz, Tian-Shan, north-west India south-eastEurope, Asia Minor, Caucasus, Transcaucasia, western Siberia, Altai, Turan and Kopet-Dagh.[3]

Description[edit]

The Eastern Baton Blue is 20 to 26mm in size. The male butterfly is pale dusky-blue in colour with a broad border while the female is brown. The butterfly is named for its prominent chequered fringe.[4]

Subspecies[edit]

See also[edit]

Cited references[edit]

  1. ^ Card for species vicrama in LepIndex. Accessed 14 October 2006.
  2. ^ a b c Evans,W.H.(1932) The Identification of Indian Butterflies, ser no H22.2, pg 225.
  3. ^ a b Page on Marrku Savela's site for genus Pseudophilotes (Lycaenidae).
  4. ^ a b Wynter-Blyth, M.A. (1957) Butterflies of the Indian Region, pg 281.

References[edit]

  • Beccaloni, G. W., Scoble, M. J., Robinson, G. S. & Pitkin, B. (Editors). 2003. The Global Lepidoptera Names Index (LepIndex). World Wide Web electronic publication. http://www.nhm.ac.uk/entomology/lepindex [accessed 14 October 2006].
  • Evans, W.H. (1932) The Identification of Indian Butterflies. (2nd Ed), Bombay Natural History Society, Mumbai, India.
  • Marrku Savela's Website on Lepidoptera [1].
  • Wynter-Blyth, M.A. (1957) Butterflies of the Indian Region, Bombay Natural History Society, Mumbai, India.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!