Overview

Comprehensive Description

General Description

A medium-size (approx. 3.0 – 3.2 cm. wingspan) olive green moth with black and white lines and spots. The antemedian and postmedian lines are very erratic, black lined with white scales. The orbicular and reniform spots are prominent, white with green filling and partially ringed with black. The fringes are checkered green, black and white. The hindwings are light black, with some pale scaling along the upper edge and a pale fringe. Sexes are similar, but males have narrowly bipectinate antenna, females simple. Feralia jocosa can usually be separated from other Alberta Feralia by the combination of small size, dark hindwings, and the lack of blocks or large patches of black scales on the forewings. Occasional specimens have some or all the olive green replaced with yellow-brown. Adults and the genitalia of both sexes are illustrated by Poole (1995).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northeastern USA, south to Maryland and Ohio, north to Newfoundland and west across the boreal forest to coastal BC, but replaced in the lower mainland and Vancouver Island by F. deceptiva. Open dots on the map are literature records only (Prentice, 1962).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

In Alberta it occurs in coniferous and mixedwood forest throughout the boreal forest, foothills and mountains.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Feralia jocosa is single-brooded, with adults in spring (late April through mid June). They lay eggs which hatch about the time the conifer buds are emerging, and most of their development occurs from the time the bud scales drop to the time the new needles have hardened, a period of 6 weeks or less. The adults develop in the pupa prior to winter, prepared to emerge early in the spring. The larvae are described and illustrated in color by Duncan (2006).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Feralia jocosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Feralia jocosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTTCCGTTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCTTTAACCCTTCTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCATCAAATATCGCCCATGGAGGAAGTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCCTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGTAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Feralia jocosa

The Jocose Sallow (Feralia jocosa) is a species of moth of the Noctuidae family. It is found from the northeastern parts of the United States south to Maryland and Ohio, north to Newfoundland and west across the boreal forest to coastal British Columbia. In the lower mainland of Canada and Vancouver Island the species is replaced by Feralia deceptiva.

The wingspan is 30–32 mm. The moth flies from April to June depending on the location.

The larvae feed on pinus species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!