Articles on this page are available in 1 other language: Spanish (5) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Vanessa virginiensis (the American painted lady) is resident throughout the United States and southern Canada, and migratory northward from there, and ranges south to Venezuela and the Greater Antilles, straying rarely to southwest Europe and other places (Scott 1986). Habitats are nearly everywhere in open areas from subtropics to lower Canadian zone. Host plants are herbaceous and include species from many families with a preference for Compositae (tribe Inuleae), but also including Borginaceae, Leguminosae, Malvaceae, Urticaceae, Balsaminaceae, and Scrophulariaceae. Eggs are laid on the host plant singly. Individuals overwinter as adults, and possibly pupae. There are variable numbers of flights each year depending on latitude, with many flights all year in the southern parts of their range, and only two flights in the north (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The two large eyespots on the hindwing underside separate this species from the numerous smaller eyespots of the other ladies (V. cardui and V. annabella). There are no described subspecies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern Canada (one record from Churchill, MB) south to Colombia (Opler 1999).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Subarctic North America south to Mexico. Also naturalized in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

No defined habitat preferences in Alberta; occurs as a rare migrant only.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Any disturbed or otherwise open setting with foodplants, easily locating even small forest openings. A transient colonizer and long distance migrant not capable of surviving year round in much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The larvae feed on member of the aster family (Asteraceae), particularly cudweed (Gnaphalium spp.) and and everlasting (Antennaria spp.) (Layberry et al. 1998). There are no larval records for western Canada (Guppy & Shepard 2001).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Flowering Plants Visited by Vanessa virginiensis in Illinois

Vanessa virginiensis Drury: Nymphalidae, Lepidoptera
(observations are from Robertson, Graenicher, Reed, Clinebell, and Catling; this butterfly is the American Painted Lady)

Asclepiadaceae: Asclepias purpurascens [plpr sn] (Rb); Asteraceae: Antennaria neglecta [unsp sn] (Gr), Antennaria plantaginifolia [stam sn] (Rb), Aster drummondii sn (Gr), Aster laevis sn (Gr), Aster lanceolatus sn (Rb), Aster novae-angliae sn (Gr), Aster pilosus sn (Rb), Aster prenanthoides sn (Gr), Aster puniceus sn (Gr), Aster salicifolius sn (Rb), Bidens cernua sn (Rb), Boltonia asterioides sn (Rb), Cirsium altissimum sn (Gr), Cirsium arvense sn (Gr), Coreopsis palmata sn (Rb), Echinacea pallida sn (Rb, Cl), Echinacea purpurea sn (Rb), Eupatoriadelphus purpureus sn (Rb, Gr), Euthamia graminifolia sn (Rb, Gr), Helianthus grosseserratus sn (Rb), Helianthus strumosus sn (Gr), Heliopsis helianthoides sn (Gr), Rudbeckia laciniata sn (Rb), Silphium perfoliatum sn (Rb), Solidago juncea sn (Gr), Solidago speciosa sn (Re), Taraxacum officinale sn (Rb); Boraginaceae: Lithospermum canescens sn (Rb); Caprifoliaceae: Symphoricarpos occidentalis sn (Gr), Viburnum prunifolium sn (Rb); Caryophyllaceae: Stellaria media sn (Rb); Cornaceae: Cornus obliqua sn (Rb); Dipsacaceae: Dipsacus fullonum sn (Rb); Fabaceae: Cercis canadensis sn np (Rb), Melilotus alba sn (Rb), Trifolium pratense sn fq (Rb), Trifolium repens sn (Rb); Lamiaceae: Monarda bradburiana sn (Rb), Monarda fistulosa sn (Rb), Nepeta cataria sn (Rb), Pycnanthemum tenuifolium sn fq (Rb); Lauraceae: Sassafras albidum sn (Rb); Liliaceae: Camassia scilloides sn (Rb); Orchidaceae: Spiranthes vernalis sn np (Ct); Parnassiaceae: Parnassia glauca sn (Gr); Polemoniaceae: Phlox pilosa sn (Rb); Rosaceae: Crataegus intricata (Rb), Prunus americana sn (Rb), Prunus serotina [flwr sn] (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb); Salicaceae: Salix nigra [stam sn] (Rb); Scrophulariaceae: Veronicastrum virginicum sn (Rb); Violaceae: Viola cucullata sn (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Common in eastern part of range, rarer in western.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Adults feed on flower nectar and mud (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

There are two Alberta records are from July and one from September.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Not certain how far north this can overwinter, but definitely not most or all of Virginia and North Carolina. Migrants arrive end of March or April in southern New Jersey and get into southern Canada in May. They then occur as breeders all summer and fall if conditions are favorably, usually with the last observations in late November or December in New Jersey. These observations and dates are similar for much of the eastern USA. Regular observations from mid January through February would strongly indicate overwintering.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The caterpillar is black with a complex pattern of yellow or white bands and lateral spots. The spines are black with a red base (Layberry et al. 1998). The American Lady is rare in western Canada, and occurs only as an occasional migrant; it is more common in eastern Canada, where it forms two additional generations after immigrating in May (Layberry et al. 1998). Judging by the dates, the Alberta specimens may have originated from migrants of these second and third generations; perhaps this species 'leap-frogs' northward with progressive generations in good years.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanessa virginiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTTAGTTTATTAATTCGAACTGAACTAGGTAATCCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATGTTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAATATTATTAATTTCTAGCAGAATTGTAGAAAACGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAACATTGCTCATAGAGGATCATCTGTGGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATCAATATACGAGTTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTACTTTCTTTACCTGTATTAGCCGGAGCTATTACTATACTTTTAACAGATCGAAATATTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACATCTATTTTGATTTTTCGGACATCCAGAAGTTTATATTTTAATTTTACCAGGTTTCGGTATAATTTCACATATTATTTCCCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGGATAATTTACGCTATAATAGCAATTGGATTATTGGGGTTTATTGTTTGAGCACATCATATATTTACAGTAGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vanessa virginiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

A rare migrant, not established in Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, abundant, and tolerates disturbance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American painted lady

Not to be confused with American Woman.

The American Painted Lady or American Lady (Vanessa virginiensis)[1] is a butterfly found throughout North America.

Vanessa virginiensis lives in flowery habitats, usually in mountains. The larvae feed on various Asteraceae, especially the cudweeds of genus Gnaphalium. All stages of the life cycle can be found throughout temperate North America as well as Madeira and the Canary Islands. Occasionally individuals can be found as far as south-west Europe.

Description[edit]

Vanessa virginiensis is most easily distinguishable by its two large eyespots on the ventral side, whereas V. cardui has four small eyespots and V. annabella has none. V. virginiensis also uniquely features a white dot within the forewing subapical field, set in pink on the underside and usually also in the dorsal side's orange field.

The largest spot in the black forewing tips is white in V. cardui, pale orange in this species, and orange in the West Coast species. The latter also has a purer orange background color of the dorsal side, as opposed to the darker and (especially in V. virginiensis) redder hue of the other two.

A less reliable indicator is the row of black eyespots on the dorsal submarginal hindwing. In the American Painted Lady, those on the opposite ends of the row are often larger and have blue "pupils". In V. annabella, this applies to the inner two spots, while in V. cardui some of the black eyespots may have tiny blue pupils in the summer morph, but usually have none at all, and the eyespots themselves are all roughly the same size. The size of the wings are about 5 cm (2 in) across.

Distinguishing features[edit]

See Painted Lady

Gallery[edit]

References[edit]

  1. ^ Marrku Savela's Website on Lepidoptera on Vanessa genus.
  • Riley, N.D. and Higgens, L.G. 1970. A Field Guide to the Butterflies of Britain and Europe. Collins, Great Britain. [ISBN 0-00-212028-3]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly called V. HUNTERI.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!